地址:武汉市洪山区光谷大道35号光谷总部国际时代 二期1栋1301
电话:18372041646
传真:18771997407
邮箱:sales@amyjet.com

艾美捷科技特约代理Assaypro全系列产品。
Assaypro公司致力于为学术研究和制药、生物技术产业的研究人员,提供高质量的成套免疫吸附试剂。AssayPro的产品线包括 AssayMax 酶联免疫吸附试剂盒、AssaySense 活性测定盒、抗体和其他相关试剂。Assaypro提供给客户的试剂不仅具有价格上的竞争力,而且还可以定制产品,以满足客户的特定需求。
| 类别 | Catalog No. | Product Name | Format | Size |
| Proteins | PF35214 | Bovine Factor IX | Purified Protein | 0.1 mg |
| Proteins | PI90111 | Bovine Immunoglobulin G (IgG) | Purified Protein | 20 mg |
| Proteins | PI90112 | Bovine Immunoglobulin G (IgG) | Purified Protein | 50 mg |
| Proteins | PES3001 | C. elegans SNAP25 | Recombinant Protein | 20 ug |
| Proteins | PF10811 | Canine Fibrinogen (FBG) | Purified Protein | 0.5 mg |
| Proteins | PCI33626 | Canine IFN-gamma | Recombinant Protein | 20 ug |
| Proteins | PHC30851 | Carbonic Anhydrase 2 (CA2) | Recombinant Protein | 20 ug |
| Proteins | PDD32755 | Dengue Virus 2 Envelope Protein (DENV) | Recombinant Protein | 20 ug |
| Proteins | PA60091 | Dog Apotransferrin | Purified Protein | 1 mg |
| Proteins | PEC0801 | E. coli Carbonic Anhydrase 2 (CA2) | Recombinant Protein | 20 ug |
| Proteins | PEC31041 | E. coli CysH | Recombinant Protein | 20 ug |
| Proteins | PED31021 | E. coli deoC | Recombinant Protein | 20 ug |
| Proteins | PED33011 | E. coli DnaJ (Amino Acids 1-376) | Recombinant Protein | 20 ug |
| Proteins | PED3002 | E. coli DnaK (1-384 aa) | Recombinant Protein | 20 ug |
| Proteins | PED3003 | E. coli DnaK (385-638aa) | Recombinant Protein | 20 ug |
| Proteins | PED33004 | E. coli DnaK (508-638 aa) | Recombinant Protein | 20 ug |
| Proteins | PEG3233 | E. coli GLK | Recombinant Protein | 10 ug |
| Proteins | PEG3062 | E. coli Glycerol Kinase | Recombinant Protein | 20 ug |
| Proteins | PEG31423 | E. coli GOR | Recombinant Protein | 20 ug |
| Proteins | PEG33001 | E. coli GroEL | Recombinant Protein | 20 ug |
| Proteins | PEL31634 | E. coli ldhA | Recombinant Protein | 20 ug |
| Proteins | PEM30801 | E. coli Maltose Binding Protein (MBP) | Recombinant Protein | 100 ug |
| Proteins | PEM31025 | E. coli Methionine Aminopeptidase (MAP) | Recombinant Protein | 20 ug |
| Proteins | PEN31032 | E. coli nanA | Recombinant Protein | 20 ug |
| Proteins | PEN31424 | E. coli NDK | Recombinant Protein | 20 ug |
| Proteins | PEP1132 | E. coli PPA | Recombinant Protein | 20 ug |
| Proteins | PEP31503 | E. coli PYKF | Recombinant Protein | 20 ug |
| Proteins | PES30589 | E. coli SKP | Recombinant Protein | 20 ug |
| Proteins | PES31037 | E. coli Superoxide Dismutase (SodA, MnSOD) | Recombinant Protein | 20 ug |
| Proteins | PHL31057 | E. coli Thiol Peroxidase (TPX) | Recombinant Protein | 20 ug |
| Proteins | PET30540 | E. coli Thioredoxin Reductase (TRXB) | Recombinant Protein | 20 ug |
| Proteins | PET32963 | E. coli Tryptophanase (Tnase) | Recombinant Protein | 20 ug |
| Proteins | PHU30661 | E. coli Uridine Phosphorylase (UPase) | Recombinant Protein | 20 ug |
| Proteins | PHG30905 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) | Recombinant Protein | 20 ug |
| Proteins | PHG31053 | E.coli Glutaminase 1 (glsA1) | Recombinant Protein | 20 ug |
| Proteins | PEG32824 | E.coli Glycerol Dehydrogenase (GLDA) | Recombinant Protein | 20 ug |
| Proteins | PHG32833 | E.coli IDNK | Recombinant Protein | 20 ug |
| Proteins | PHH32766 | Genome Polyprotein (HCV-Core) | Recombinant Protein | 20 ug |
| Proteins | PHH32758 | Hepatitis C Virus E2 | Recombinant Protein | 20 ug |
| Proteins | PHH30519 | Hepatitis C Virus Genotype 3 NS3 | Recombinant Protein | 20 ug |
| Proteins | PHV31686 | Human VAMP7 | Recombinant Protein | 20 ug |
| Proteins | PH130435 | Human 14-3-3 sigma | Recombinant Protein | 20 ug |
| Proteins | PHP33156 | Human 26S Proteasome Subunit S5B (PSMD5) | Recombinant Protein | 20 ug |
| Proteins | PHH30518 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) | Recombinant Protein | 20 ug |
| Proteins | PHK30948 | Human 3-Ketodihydrosphingosine Reductase (KDSR) | Recombinant Protein | 20 ug |
| Proteins | PH430308 | Human 4-1BB Ligand | Recombinant Protein | 20 ug |
| Proteins | PH430379 | Human 4E-BP1 | Recombinant Protein | 20 ug |
| Proteins | PHA30674 | Human ACAA1 | Recombinant Protein | 20 ug |
| Proteins | PHA32421 | Human ACAD8 | Recombinant Protein | 20 ug |
| Proteins | PHA31800 | Human ACAT1 | Recombinant Protein | 20 ug |
| Proteins | PHA0634 | Human ACAT2 | Recombinant Protein | 20 ug |
| Proteins | PHA30280 | Human Acid Phosphatase 1 (ACP1) | Recombinant Protein | 20 ug |
| Proteins | PHA32959 | Human ACP2 | Recombinant Protein | 20 ug |
| Proteins | PHA33015 | Human ACP6 | Recombinant Protein | 20 ug |
| Proteins | PHA33164 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) | Recombinant Protein | 20 ug |
| Proteins | PHA32436 | Human Acyl-CoA Thioesterase 11 (ACOT11) | Recombinant Protein | 20 ug |
| Proteins | PHA31340 | Human Acyl-CoA Thioesterase 7 (ACOT7) | Recombinant Protein | 20 ug |
| Proteins | PHA32115 | Human Acyl-coenzyme A Thioesterase 8 | Recombinant Protein | 20 ug |
| Proteins | PHA30928 | Human Acylphosphatase-1 (ACYP1) | Recombinant Protein | 20 ug |
| Proteins | PHA32636 | Human ADAL | Recombinant Protein | 20 ug |
| Proteins | PHA30483 | Human Adenine Phosphoribosyltransferase (APRT) | Recombinant Protein | 20 ug |
| Proteins | PHA30606 | Human Adenosylhomocysteinase (AHCY) | Recombinant Protein | 20 ug |
| Proteins | PHA40901 | Human Adenylate Kinase 2 (AK 2) | Recombinant Protein | 20 ug |
| Proteins | PHA30801 | Human Adenylate Kinase 4 (AK 4) | Recombinant Protein | 20 ug |
| Proteins | PHA30769 | Human Adenylate Kinase Isoenzyme 1 (AK 1) | Recombinant Protein | 20 ug |
| Proteins | PHA31275 | Human Adenylosuccinate Lyase (ADSL) | Recombinant Protein | 20 ug |
| Proteins | PHA31975 | Human ADI1 | Recombinant Protein | 20 ug |
| Proteins | PHA2641 | Human Adiponectin (ACRP30) | Recombinant Protein | 20 ug |
| Proteins | PHA30501 | Human Adiponectin (ACRP30) | Recombinant Protein | 20 ug |
| Proteins | PHA30558 | Human ADK | Recombinant Protein | 10 ug |
| Proteins | PHA30644 | Human ADP-Ribosylation Factor 1 (ARF1) | Recombinant Protein | 20 ug |
| Proteins | PHA31215 | Human ADP-Ribosylation Factor 3 (ARF3) | Recombinant Protein | 20 ug |
| Proteins | PHA30802 | Human ADP-Ribosylation Factor 6 (ARF6) | Recombinant Protein | 20 ug |
| Proteins | PHA30660 | Human ADP-Ribosylation Factor-like Protein 1 (ARL1) | Recombinant Protein | 20 ug |
| Proteins | PHA30845 | Human ADP-Ribosylation Factor-like Protein 2 (ARL2) | Recombinant Protein | 20 ug |
| Proteins | PHA30765 | Human ADP-Ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) | Recombinant Protein | 20 ug |
| Proteins | PHA31633 | Human ADPRH | Recombinant Protein | 20 ug |
| Proteins | PHA31096 | Human AGR3 | Recombinant Protein | 20 ug |
| Proteins | PHA30701 | Human AHA1 | Recombinant Protein | 20 ug |
| Proteins | PHA30369 | Human AHSP | Recombinant Protein | 20 ug |
| Proteins | PHA31022 | Human AIMP/p18 | Recombinant Protein | 20 ug |
| Proteins | PHA30880 | Human AK3L1 | Recombinant Protein | 20 ug |
| Proteins | PHA30314 | Human AKR1B10 | Recombinant Protein | 20 ug |
| Proteins | PHA30496 | Human AKR1C1 | Recombinant Protein | 20 ug |
| Proteins | PHA30270 | Human AKR1C3 | Recombinant Protein | 20 ug |
| Proteins | PHA31106 | Human AKR1C4 | Recombinant Protein | 20 ug |
| Proteins | PHA32915 | Human AKT1 | Recombinant Protein | 20 ug |
| Proteins | PHA30433 | Human Alcohol Dehydrogenase (AKR1A1) | Recombinant Protein | 20 ug |
| Proteins | PHA31432 | Human Alcohol Dehydrogenase 1A (ADH1A) | Recombinant Protein | 20 ug |
| Proteins | PHA1593 | Human Alcohol Dehydrogenase 1C (ADH1C) | Recombinant Protein | 20 ug |
| Proteins | PHA31564 | Human Alcohol Dehydrogenase 6 (ADH6) | Recombinant Protein | 20 ug |
| Proteins | PHA30405 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) | Recombinant Protein | 20 ug |
| Proteins | PHA0905 | Human ALDH2 | Recombinant Protein | 20 ug |
| Proteins | PHA30477 | Human Aldolase A | Recombinant Protein | 20 ug |
| Proteins | PHA31404 | Human Aldolase B | Recombinant Protein | 20 ug |
| Proteins | PHA30980 | Human Aldolase C | Recombinant Protein | 20 ug |
| Proteins | PHA30901 | Human Aldose Reductase (AR) | Recombinant Protein | 20 ug |
| Proteins | PHA30482 | Human ALIX | Recombinant Protein | 20 ug |
| Proteins | PHA31016 | Human ALKBH2 | Recombinant Protein | 20 ug |
| Proteins | PHA33001 | Human alpha A Crystallin | Recombinant Protein | 20 ug |
| Proteins | PHA33002 | Human alpha B Crystallin | Recombinant Protein | 20 ug |
| Proteins | PHA31143 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) | Recombinant Protein | 20 ug |
| Proteins | PHA31145 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) | Purified Protein | 500 ug |
| Proteins | PA60041 | Human alpha-1-Antichymotrypsin (AACT) | Purified Protein | 100 ug |
| Proteins | PHA30420 | Human alpha-1-Antichymotrypsin (AACT) | Recombinant Protein | 20 ug |
| Proteins | PA60051 | Human alpha-1-Antitrypsin (A1AT) | Purified Protein | 500 ug |
| Proteins | PHA309011 | Human alpha-1-Antitrypsin (A1AT) | Recombinant Protein | 20 ug |
| Proteins | PA51101 | Human alpha-1-Microglobulin (A1M) | Purified Protein | 200 ug |
| Proteins | PA65398 | Human alpha-2-Antiplasmin | Purified Protein | 100 ug |
| Proteins | PA50011 | Human alpha-2-Macroglobulin (A2M) | Purified Protein | 250 ug |
| Proteins | PHL31384 | Human Alpha-2-macroglobulin Receptor-associated Prote | Recombinant Protein | 20 ug |
| Proteins | PHA33162 | Human alpha-Actinin-1 (ACTN1) | Recombinant Protein | 20 ug |
| Proteins | PHE30457 | Human alpha-Endosulfine (ENSA) | Recombinant Protein | 20 ug |
| Proteins | PHA33169 | Human alpha-Fetoprotein (AFP) | Recombinant Protein | 10 ug |
| Proteins | PHF12021 | Human alpha-Fetoprotein (AFP) | Purified Protein | 100 ug |
| Proteins | PHA30981 | Human alpha-Ketoglutarate-dependent Dioxygenase AlkB Homolog 3 (ALKBH3) | Recombinant Protein | 20 ug |
| Proteins | PHN30708 | Human alpha-Soluble NSF Attachment Protein (NAPA) | Recombinant Protein | 20 ug |
| Proteins | PHS2004 | Human alpha-Synuclein | Recombinant Protein | 20 ug |
| Proteins | PHA32001 | Human alpha-Synuclein | Recombinant Protein | 20 ug |
| Proteins | PHA32006 | Human alpha-synuclein | Recombinant Protein | 20 ug |
| Proteins | PHA34002 | Human alpha-synuclein | Recombinant Protein | 20 ug |
| Proteins | PT62011 | Human alpha-Thrombin | Purified Protein | 50 ug |
| Proteins | PT62012 | Human alpha-Thrombin | Purified Protein | 250 ug |
| Proteins | PHA31829 | Human Amelotin | Recombinant Protein | 20 ug |
| Proteins | PHA32779 | Human Amisyn | Recombinant Protein | 20 ug |
| Proteins | PHA31817 | Human AMPK beta 2 | Recombinant Protein | 20 ug |
| Proteins | PHA33051 | Human AMT | Recombinant Protein | 20 ug |
| Proteins | PHA31226 | Human AMY-1 | Recombinant Protein | 20 ug |
| Proteins | PHA31499 | Human Amyloid Precursor Protein (APP) | Recombinant Protein | 20 ug |
| Proteins | PHA32604 | Human Angiogenin (ANG) | Recombinant Protein | 20 ug |
| Proteins | PHA31236 | Human Angiopoietin-1 (ANG-1) | Recombinant Protein | 20 ug |
| Proteins | PHA36822 | Human Angiotensinogen | Purified Protein | 20 ug |
| Proteins | PHA31420 | Human Annexin A10 (ANXA10) | Recombinant Protein | 20 ug |
| Proteins | PHA30771 | Human Annexin A11 (ANXA11) | Recombinant Protein | 20 ug |
| Proteins | PHA31014 | Human Annexin A13 (ANXA13) | Recombinant Protein | 20 ug |
| Proteins | PHA30453 | Human Annexin A3 (ANXA3) | Recombinant Protein | 20 ug |
| Proteins | PHA30463 | Human Annexin A4 (ANXA4) | Recombinant Protein | 20 ug |
| Proteins | PHA30406 | Human Annexin A5 (ANXA5) | Recombinant Protein | 20 ug |
| Proteins | PHA31407 | Human Annexin A7 (ANXA7) | Recombinant Protein | 20 ug |
| Proteins | PHA30682 | Human Annexin A8 (ANXA8) | Recombinant Protein | 20 ug |
| Proteins | PA50031 | Human Antithrombin III (AT3) | Purified Protein | 100 ug |
| Proteins | PHA32571 | Human Antithrombin III (AT3) | Recombinant Protein | 20 ug |
| Proteins | PHA31803 | Human AP3S1 | Recombinant Protein | 20 ug |
| Proteins | PHA32962 | Human APMAP | Recombinant Protein | 20 ug |
| Proteins | PA20011 | Human Apolipoprotein A-I (Apo A1) | Purified Protein | 0.5 mg |
| Proteins | PA20012 | Human Apolipoprotein A-I (Apo A1) | Purified Protein | 200 ug |
| Proteins | PHA0363 | Human Apolipoprotein A-I (Apo A1) | Recombinant Protein | 20 ug |
| Proteins | PA20021 | Human Apolipoprotein A-II (Apo A2) | Purified Protein | 200 ug |
| Proteins | PHA2476 | Human Apolipoprotein A-V (Apo A5) | Recombinant Protein | 10 ug |
| Proteins | PA20041 | Human Apolipoprotein B (Apo B) | Purified Protein | 100 ug |
| Proteins | PA20051 | Human Apolipoprotein C-I (Apo C1) | Purified Protein | 100 ug |
| Proteins | PHA2554 | Human Apolipoprotein C-I (Apo C1) | Recombinant Protein | 10 ug |
| Proteins | PA20061 | Human Apolipoprotein C-II (Apo C2) | Purified Protein | 50 ug |
| Proteins | PA20071 | Human Apolipoprotein C-III (Apo C3) | Purified Protein | 50 ug |
| Proteins | PA20072 | Human Apolipoprotein C-III (Apo C3) | Purified Protein | 100 ug |
| Proteins | PA20091 | Human Apolipoprotein E (Apo E) | Purified Protein | 50 ug |
| Proteins | PA70152 | Human Apolipoprotein H (Apo H, B2GP1) | Purified Protein | 100 ug |
| Proteins | PHC32574 | Human Apolipoprotein J | Recombinant Protein | 20 ug |
| Proteins | PHA31671 | Human Apoptosis with CARD | Recombinant Protein | 20 ug |
| Proteins | PHA32598 | Human Apoptosis-Inducing Factor 1 (AIF) | Recombinant Protein | 20 ug |
| Proteins | PHA32602 | Human APRIL | Recombinant Protein | 20 ug |
| Proteins | PHA31137 | Human ARA9 | Recombinant Protein | 20 ug |
| Proteins | PHA31252 | Human ARF4L | Recombinant Protein | 20 ug |
| Proteins | PHA31100 | Human ARF5 | Recombinant Protein | 20 ug |
| Proteins | PHA31271 | Human Argininosuccinate Lyase (ASL) | Recombinant Protein | 20 ug |
| Proteins | PHA31665 | Human ARH3 | Recombinant Protein | 20 ug |
| Proteins | PHA1130 | Human ARL11 | Recombinant Protein | 20 ug |
| Proteins | PHA31219 | Human ARL14 | Recombinant Protein | 20 ug |
| Proteins | PHA1222 | Human ARL3 | Recombinant Protein | 20 ug |
| Proteins | PHA31155 | Human ARL5B | Recombinant Protein | 20 ug |
| Proteins | PHA31465 | Human ARMET | Recombinant Protein | 20 ug |
| Proteins | PHA32087 | Human Arylsulfatase A (ASA) | Recombinant Protein | 20 ug |
| Proteins | PHA31885 | Human Arylsulfatase G (ARSG) | Recombinant Protein | 20 ug |
| Proteins | PHA32643 | Human ASAM | Recombinant Protein | 20 ug |
| Proteins | PHA31776 | Human ASGR2 | Recombinant Protein | 20 ug |
| Proteins | PHA31943 | Human Aspartate Aminotransferase -Mitochondrial (mAspAT, GOT2) | Recombinant Protein | 20 ug |
| Proteins | PHA30600 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) | Recombinant Protein | 20 ug |
| Proteins | PHA31421 | Human Aspartoacylase (ASPA) | Recombinant Protein | 20 ug |
| Proteins | PHA31454 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) | Recombinant Protein | 20 ug |
| Proteins | PHA1768 | Human ASPRV1 | Recombinant Protein | 20 ug |
| Proteins | PHA32947 | Human AT6V1F | Recombinant Protein | 20 ug |
| Proteins | PHA31127 | Human ATF3 | Recombinant Protein | 20 ug |
| Proteins | PHA31742 | Human ATG10 | Recombinant Protein | 20 ug |
| Proteins | PHA1431 | Human ATG4B | Recombinant Protein | 20 ug |
| Proteins | PHA30434 | Human ATOX1 | Recombinant Protein | 20 ug |
| Proteins | PHA30847 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) | Recombinant Protein | 20 ug |
| Proteins | PHA31630 | Human ATPase Inhibitory Factor 1/IF1 | Recombinant Protein | 20 ug |
| Proteins | PHA30343 | Human Aurora A | Recombinant Protein | 10 ug |
| Proteins | PHA30394 | Human Aurora Kinase B (AURKB) | Recombinant Protein | 10 ug |
| Proteins | PHA32957 | Human AZGP1 | Recombinant Protein | 20 ug |
| Proteins | PA30011 | Human Azurocidin | Purified Protein | 100 ug |
| Proteins | PHB30438 | Human BAALC | Recombinant Protein | 20 ug |
| Proteins | PHB30801 | Human BAFF | Recombinant Protein | 20 ug |
| Proteins | PHB30508 | Human BAG1 | Recombinant Protein | 20 ug |
| Proteins | PHB31373 | Human BAIAP2 | Recombinant Protein | 20 ug |
| Proteins | PHB30929 | Human BATF | Recombinant Protein | 20 ug |
| Proteins | PHB30297 | Human Bcl-2 | Recombinant Protein | 20 ug |
| Proteins | PHB30454 | Human Bcl-2-like Protein 2 (BCL2L2) | Recombinant Protein | 20 ug |
| Proteins | PHB31857 | Human BCL2L10 | Recombinanat Protein | 20 ug |
| Proteins | PHB31842 | Human BCMA | Recombinant Protein | 20 ug |
| Proteins | PHB30882 | Human BDH2 | Recombinant Protein | 20 ug |
| Proteins | PHB3000 | Human BDNF | Recombinant Protein | 20 ug |
| Proteins | PHC0584 | Human beta B1 Crystallin | Recombinant Protein | 20 ug |
| Proteins | PHB0905 | Human beta IG-H3 | Recombinant Protein | 20 ug |
| Proteins | PHB32114 | Human beta-1,3-Glucuronyltransferase 3 (GlcAT-I, B3GAT3) | Recombinant Protein | 20 ug |
| Proteins | PM50011 | Human beta-2-Microglobulin (B2M) | Purified Protein | 0.5 mg |
| Proteins | PHB33095 | Human beta-Sarcoglycan (SGCB) | Recombinant Protein | 20 ug |
| Proteins | PHA32011 | Human beta-Synuclein | Recombinant Protein | 20 ug |
| Proteins | PHB30601 | Human BHMT | Recombinant Protein | 20 ug |
| Proteins | PHB31801 | Human BIF-1 | Recombinant Protein | 20 ug |
| Proteins | PHAT30377 | Human Biliverdin Reductase A (BLVR A) | Recombinant Protein | 20 ug |
| Proteins | PHB0901 | Human BLVRB | Recombinant Protein | 20 ug |
| Proteins | PHB30905 | Human BMP-2 | Recombinant Protein | 20 ug |
| Proteins | PHB30904 | Human BMP-4 | Recombinant Protein | 20 ug |
| Proteins | PHB30350 | Human BMP-5 | Recombinant Protein | 20 ug |
| Proteins | PHB0906 | Human BMP-7 | Recombinant Protein | 20 ug |
| Proteins | PHB32912 | Human BNIP1 | Recombinant Protein | 20 ug |
| Proteins | PHB31911 | Human BolA-like Protein 1 (hBolA) | Recombinant Protein | 20 ug |
| Proteins | PHB33108 | Human BOLA3 | Recombinant Protein | 20 ug |
| Proteins | PHB30527 | Human BPGM | Recombinant Protein | 20 ug |
| Proteins | PHB30870 | Human BPHL | Recombinant Protein | 20 ug |
| Proteins | PHB0801 | Human Brain Natriuretic Peptide (BNP) | Recombinant Protein | 20 ug |
| Proteins | PHB32867 | Human BRD1 | Recombinant Protein | 20 ug |
| Proteins | PHB32911 | Human BRD3 | Recombinant Protein | 20 ug |
| Proteins | PHB31552 | Human BRDG 1 | Recombinant Protein | 20 ug |
| Proteins | PHB36818 | Human Butyrylcholinesterase (BCHE) | Purified Protein | 1 unit |
| Proteins | PHD30397 | Human C-C Motif Chemokine 22 (MDC) | Recombinant Protein | 20 ug |
| Proteins | PC10011 | Human C-Reactive Protein (CRP) | Purified Protein | 200 ug |
| Proteins | PHC32205 | Human C-type Natriuretic Peptide (CNP) | Recombinant Protein | 20 ug |
| Proteins | PHC36819 | Human C1 esterase inhibitor | Purified Protein | 100 ug |
| Proteins | PHC310911 | Human C11ORF79 | Recombinant Protein | 20 ug |
| Proteins | PHC31061 | Human C1ORF41 | Recombinant Protein | 20 ug |
| Proteins | PHC30811 | Human C1QBP | Recombinant Protein | 20 ug |
| Proteins | PHC31926 | Human CAB39L | Recombinant Protein | 20 ug |
| Proteins | PHC30381 | Human Calbindin 1 | Recombinant Protein | 20 ug |
| Proteins | PHC30861 | Human Calcium and Integrin-binding 1 (CIB1) | Recombinant Protein | 20 ug |
| Proteins | PHC30597 | Human Calcium binding protein P22 | Recombinant Protein | 20 ug |
| Proteins | PHC30801 | Human Calmodulin 2 | Recombinant Protein | 20 ug |
| Proteins | PHC31858 | Human Calmodulin-Like Protein 3 (CALML3) | Recombinant Protein | 20 ug |
| Proteins | PHC30388 | Human Calnexin (CANX) | Recombinant Protein | 20 ug |
| Proteins | PHC32681 | Human Calpain small subunit 1 | Recombinant Protein | 20 ug |
| Proteins | PHC31111 | Human Calpain-1 | Purified Protein | 25 ug |
| Proteins | PHC32579 | Human Calponin 2 | Recombinant Protein | 20 ug |
| Proteins | PHC32573 | Human Calreticulin-3 (CALR3) | Recombinant Protein | 20 ug |
| Proteins | PHC30694 | Human Calretinin | Recombinant Protein | 20 ug |
| Proteins | PHC30502 | Human Calsequestrin 2 | Recombinant Protein | 20 ug |
| Proteins | PHC30315 | Human Calumenin | Recombinant Protein | 20 ug |
| Proteins | PHC32776 | Human CAMKCN2 | Recombinant Protein | 20 ug |
| Proteins | PHA32449 | Human cAMP-Regulated Phosphoprotein 19 (ARP19) | Recombinant Protein | 20 ug |
| Proteins | PHC30439 | Human CAPG | Recombinant Protein | 20 ug |
| Proteins | PHC32356 | Human CAPZA2 | Recombinant Protein | 20 ug |
| Proteins | PHC30427 | Human Carbonic Anhydrase 1 (CA1) | Recombinant Protein | 20 ug |
| Proteins | PHC32485 | Human Carbonic Anhydrase 14 (CA14) | Recombinant Protein | 20 ug |
| Proteins | PHC30325 | Human Carbonic Anhydrase 2 (CA2) | Recombinant Protein | 20 ug |
| Proteins | PHC30503 | Human Carbonic Anhydrase 3 (CA3) | Recombinant Protein | 20 ug |
| Proteins | PHC31388 | Human Carbonic Anhydrase 8 (CA8) | Recombinant Protein | 10 ug |
| Proteins | PHC30345 | Human Carbonyl Reductase 3 (CBR3) | Recombinant Protein | 20 ug |
| Proteins | PHL31648 | Human Carboxymethylenebutenolidase Homolog | Recombinant Protein | 20 ug |
| Proteins | PHC31953 | Human Carboxypeptidase E (CPE) | Recombinant Protein | 20 ug |
| Proteins | PHC32254 | Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 21 (CEACAM21) | Recombinant Protein | 20 ug |
| Proteins | PHC32610 | Human Casein Kinase 1 alpha | Recombinant Protein | 20 ug |
| Proteins | PHC32690 | Human Casein Kinase 1 delta | Recombinant Protein | 20 ug |
| Proteins | PHC307011 | Human Casein Kinase 2 alpha (CK2 alpha) | Recombinant Protein | 10 ug |
| Proteins | PHC308015 | Human Casein Kinase 2 beta | Recombinant Protein | 10 ug |
| Proteins | PHC1624 | Human Catalase | Recombinant Protein | 20 ug |
| Proteins | PHC11241 | Human Catalase | Purified Protein | 100 ug |
| Proteins | PHC4086 | Human Cathepsin D (CTSD) | Recombinant Protein | 10 ug |
| Proteins | PHC36817 | Human Cathepsin D (CTSD) | Purified Protein | 10 ug |
| Proteins | PHC32586 | Human Cathepsin E (CTSE) | Recombinant Protein | 20 ug |
| Proteins | PHC32259 | Human Cathepsin F (CTSF) | Recombinant Protein | 20 ug |
| Proteins | PHG11654 | Human Cathepsin G (CG) | Purified Protein | 25 ug |
| Proteins | PHC31951 | Human Cathepsin S (CTSS) | Recombinant Protein | 20 ug |
| Proteins | PHC32328 | Human Cathepsin Z (CTSZ) | Recombinant Protein | 20 ug |
| Proteins | PHC0311 | Human CBR1 | Recombinant Protein | 20 ug |
| Proteins | PHC31113 | Human CBX1 | Recombinant Protein | 20 ug |
| Proteins | PHC33102 | Human CCBL1 | Recombinant Protein | 20 ug |
| Proteins | PHC30520 | Human CCL27 | Recombinant Protein | 20 ug |
| Proteins | PHC2697 | Human CD14 | Recombinant Protein | 10 ug |
| Proteins | PHC1623 | Human CD16 | Recombinant Protein | 20 ug |
| Proteins | PHP3999 | Human CD162 | Recombinant Protein | 10 ug |
| Proteins | PHC32609 | Human CD1E | Recombinant Protein | 20 ug |
| Proteins | PHC32695 | Human CD200 | Recombinant Protein | 20 ug |
| Proteins | PHC32638 | Human CD201 | Recombinant Protein | 20 ug |
| Proteins | PHC3887 | Human CD21 | Recombinant Protein | 10 ug |
| Proteins | PHC31954 | Human CD226 | Recombinant Protein | 20 ug |
| Proteins | PHC31663 | Human CD244 | Recombinant Protein | 10 ug |
| Proteins | PHC31710 | Human CD27 | Recombinant Protein | 20 ug |
| Proteins | PHC32232 | Human CD300A (CLM-8) | Recombinant Protein | 10 ug |
| Proteins | PHC32584 | Human CD33 | Recombinant Protein | 20 ug |
| Proteins | PHC32884 | Human CD37 | Recombinant Protein | 20 ug |
| Proteins | PHC33339 | Human CD38 | Recombinant Protein | 10 ug |
| Proteins | PHC32000 | Human CD3G | Recombinant Protein | 20 ug |
| Proteins | PHC31017 | Human CD40L | Recombinant Protein | 20 ug |
| Proteins | PHC31919 | Human CD42a | Recombinant Protein | 20 ug |
| Proteins | PHC33188 | Human CD47 | Recombinant Protein | 10 ug |
| Proteins | PHC33320 | Human CD47 | Recombinant Protein | 10 ug |
| Proteins | PHC32639 | Human CD5 | Recombinant Protein | 20 ug |
| Proteins | PHC32905 | Human CD58 | Recombinant Protein | 20 ug |
| Proteins | PHC4005 | Human CD6 | Recombinant Protein | 10 ug |
| Proteins | PHS3994 | Human CD62E | Recombinant Protein | 10 ug |
| Proteins | PHC32998 | Human CD70 | Recombinant Protein | 20 ug |
| Proteins | PHC33134 | Human CD74 | Recombinant Protein | 10 ug |
| Proteins | PHC31836 | Human CD79B | Recombinant Protein | 20 ug |
| Proteins | PHC3901 | Human CD8 alpha | Recombinant Protein | 10 ug |
| Proteins | PHC1735 | Human CD84 | Recombinant Protein | 20 ug |
| Proteins | PHC3895 | Human CD86 | Recombinant Protein | 10 ug |
| Proteins | PHC4006 | Human CD9 | Recombinant Protein | 10 ug |
| Proteins | PHC32970 | Human CD9 | Recombinant Protein | 20 ug |
| Proteins | PHC31095 | Human CDC26 | Recombinant Protein | 20 ug |
| Proteins | PHC0901 | Human CDC37 | Recombinant Protein | 20 ug |
| Proteins | PHC33012 | Human CDK1 | Recombinant Protein | 20 ug |
| Proteins | PHC31868 | Human CDK2AP2 | Recombinant Protein | 20 ug |
| Proteins | PHC31835 | Human CDK5 | Recombinant Protein | 20 ug |
| Proteins | PHC30480 | Human CDKA1 / DOC1 | Recombinant Protein | 20 ug |
| Proteins | PHC31377 | Human CDKN2C | Recombinant Protein | 20 ug |
| Proteins | PHC32899 | Human CEACAM3 | Recombinant Protein | 10 ug |
| Proteins | PHC32009 | Human CED6 | Recombinant Protein | 20 ug |
| Proteins | PHC30395 | Human Cell Division Cycle 42 (CDC42) | Recombinant Protein | 20 ug |
| Proteins | PHC31207 | Human CENPH | Recombinant Protein | 20 ug |
| Proteins | PHC32448 | Human Centromere Protein P (CENP-P) | Recombinant Protein | 20 ug |
| Proteins | PC70011 | Human Ceruloplasmin (CP) | Purified Protein | 0.5 mg |
| Proteins | PHC30905 | Human CHIP | Recombinant Protein | 20 ug |
| Proteins | PHC31511 | Human CHMP6 | Recombinant Protein | 20 ug |
| Proteins | PHC32572 | Human CHRNA6 | Recombinant Protein | 20 ug |
| Proteins | PHC30309 | Human Chromogranin A | Recombinant Protein | 20 ug |
| Proteins | PHC33036 | Human CHST10 | Recombinant Protein | 10 ug |
| Proteins | PHC36814 | Human Chymotrypsin | Purified Protein | 25 ug |
| Proteins | PHC32006 | Human CIAO1 | Recombinant Protein | 20 ug |
| Proteins | PHC31118 | Human CINP | Recombinant Protein | 20 ug |
| Proteins | PHC31033 | Human CIRP | Recombinant Protein | 20 ug |
| Proteins | PHC32806 | Human Citrate Synthase | Recombinant Protein | 20 ug |
| Proteins | PHC32511 | Human CKS1 | Recombinant Protein | 20 ug |
| Proteins | PHC308011 | Human CKS2 | Recombinant Protein | 20 ug |
| Proteins | PHC31902 | Human CLEC2B | Recombinant Protein | 20 ug |
| Proteins | PHC33025 | Human CLEC4E | Recombinant Protein | 20 ug |
| Proteins | PHC31020 | Human CLIC2 | Recombinant Protein | 20 ug |
| Proteins | PHC31799 | Human CLNS1A | Recombinant Protein | 20 ug |
| Proteins | PHC31915 | Human CNDP Dipeptidase 2 (CNDP2) | Recombinant Protein | 20 ug |
| Proteins | PHC31713 | Human CNRIP1 | Recombinant Protein | 20 ug |
| Proteins | PHC31156 | Human CNTF | Recombinant Protein | 20 ug |
| Proteins | PHC308012 | Human CNTF | Recombinant Protein | 20 ug |
| Proteins | PHC33010 | Human CNTFR Receptor alpha | Recombinant Protein | 20 ug |
| Proteins | PHC30701 | Human Cofilin 1 (CFL1) | Recombinant Protein | 20 ug |
| Proteins | PHC31183 | Human Cofilin-2 (CFL2) | Recombinant Protein | 20 ug |
| Proteins | PHC30579 | Human COL4A3BP | Recombinant Protein | 20 ug |
| Proteins | PHC2673 | Human Colipase (CLPS) | Recombinant Protein | 10 ug |
| Proteins | PHC31748 | Human COMMD9 | Recombinant Protein | 20 ug |
| Proteins | PHC11211BIO | Human Complement Biotin C1q | Purified Protein | 100 ug |
| Proteins | PHC12211 | Human Complement C1 | Purified Protein | 50 ug |
| Proteins | PHC11211 | Human Complement C1q | Purified Protein | 100 ug |
| Proteins | PHC12212 | Human Complement C1r Enzyme | Purified Protein | 50 ug |
| Proteins | PHC12213 | Human Complement C1s Enzyme | Purified Protein | 50 ug |
| Proteins | PHC12221 | Human Complement C2 | Purified Protein | 20 ug |
| Proteins | PC52114 | Human Complement C3 | Purified Protein | 100 ug |
| Proteins | PC52115 | Human Complement C3b | Purified Protein | 50 ug |
| Proteins | PHC11222 | Human Complement C3c | Purified Protein | 200 ug |
| Proteins | PC52117 | Human Complement C3d | Purified Protein | 25 ug |
| Proteins | PC52122 | Human Complement C4 | Purified Protein | 100 ug |
| Proteins | PHC11254 | Human Complement C4b | Purified Protein | 50 ug |
| Proteins | PC52123 | Human Complement C4c | Purified Protein | 200 ug |
| Proteins | PHC15051 | Human Complement C5 | Purified Protein | 50 ug |
| Proteins | PHC15151 | Human Complement C6 | Purified Protein | 50 ug |
| Proteins | PHC15251 | Human Complement C7 | Purified Protein | 50 ug |
| Proteins | PHC15351 | Human Complement C8 | Purified Protein | 50 ug |
| Proteins | PHA31235 | Human Complement C8 Gamma (C8G) | Recombinant Protein | 100 ug |
| Proteins | PHC32622 | Human Complement C9 | Recombinant Protein | 10 ug |
| Proteins | PF10251 | Human Complement Factor B | Purified Protein | 100 ug |
| Proteins | PHC2541 | Human Complement Factor B | Recombinant Protein | 20 ug |
| Proteins | PF10252 | Human Complement Factor Ba | Purified Protein | 25 ug |
| Proteins | PF10253 | Human Complement Factor Bb | Purified Protein | 50 ug |
| Proteins | PHC32479 | Human Complement Factor Bb (CFB-Bb) | Recombinant Protein | 20 ug |
| Proteins | PF10301 | Human Complement Factor D | Purified Protein | 25 ug |
| Proteins | PHC31877 | Human Complement Factor D | Recombinant Protein | 20 ug |
| Proteins | PHF33098 | Human Complement Factor D | Recombinant Protein | 10 ug |
| Proteins | PF10281 | Human Complement Factor H | Purified Protein | 0.1 mg |
| Proteins | PHP32745 | Human Complement Factor P (CFP) | Recombinant Protein | 20 ug |
| Proteins | PF8011 | Human Complement Factor P (Properdin) | Purified Protein | 25 ug |
| Proteins | PF8012 | Human Complement Factor P (Properdin) | Purified Protein | 50 ug |
| Proteins | PHC30901 | Human Complexin-1 (CPX I) | Recombinant Protein | 20 ug |
| Proteins | PHC0905 | Human COMT | Recombinant Protein | 10 ug |
| Proteins | PHC32994 | Human Connective Tissue Growth Factor (CTGF) | Recombinant Protein | 20 ug |
| Proteins | PHC30715 | Human Copper Chaperone For Superoxide Dismutase (CCS) | Recombinant Protein | 20 ug |
| Proteins | PHC32042 | Human Coproporphyrinogen Oxidase | Recombinant Protein | 20 ug |
| Proteins | PHC31276 | Human COPS8 | Recombinant Protein | 20 ug |
| Proteins | PHC33042 | Human COQ9 | Recombinant Protein | 20 ug |
| Proteins | PHC30858 | Human COTL1 | Recombinant Protein | 20 ug |
| Proteins | PHC31191 | Human COX4NB | Recombinant Protein | 20 ug |
| Proteins | PHC31867 | Human COX5A | Recombinant Protein | 20 ug |
| Proteins | PHC308014 | Human CPI-17 | Recombinant Protein | 20 ug |
| Proteins | PHC32148 | Human CPPED1 | Recombinant Protein | 20 ug |
| Proteins | PHC30351 | Human CRABP1 | Recombinant Protein | 20 ug |
| Proteins | PHC308013 | Human CRABP2 | Recombinant Protein | 20 ug |
| Proteins | PHC31194 | Human CRCP | Recombinant Protein | 20 ug |
| Proteins | PHC31590 | Human Creatine kinase MT | Recombinant Protein | 20 ug |
| Proteins | PHC30626 | Human Creatine kinase type B | Recombinant Protein | 20 ug |
| Proteins | PHC31689 | Human CREG1 | Recombinant Protein | 20 ug |
| Proteins | PHC2372 | Human CRIP1 | Recombinant Protein | 20 ug |
| Proteins | PHC30857 | Human Crk-like Protein (CRKL) | Recombinant Protein | 20 ug |
| Proteins | PHC31167 | Human CRYBA4 | Recombinant Protein | 20 ug |
| Proteins | PHC31184 | Human CRYGD | Recombinant Protein | 20 ug |
| Proteins | PHC1627 | Human CRYGN | Recombinant Protein | 20 ug |
| Proteins | PHC31205 | Human CRYGS | Recombinant Protein | 20 ug |
| Proteins | PHC32750 | Human CRYZ | Recombinant Protein | 20 ug |
| Proteins | PHC30550 | Human CRYZL1 | Recombinant Protein | 20 ug |
| Proteins | PHC32842 | Human CSK | Recombinant Protein | 10 ug |
| Proteins | PHC31530 | Human CSRP2 | Recombinant Protein | 10 ug |
| Proteins | PHC31659 | Human CSTF-50 | Recombinant Protein | 20 ug |
| Proteins | PHC30495 | Human CtBP1 | Recombinant Protein | 20 ug |
| Proteins | PHC3914 | Human CTLA4 | Recombinant Protein | 10 ug |
| Proteins | PHC30541 | Human CutA | Recombinant Protein | 20 ug |
| Proteins | PHC31181 | Human CUTC | Recombinant Protein | 20 ug |
| Proteins | PHC3885 | Human CX3CL1 | Recombinant Protein | 10 ug |
| Proteins | PHC32201 | Human CXADR | Recombinant Protein | 20 ug |
| Proteins | PHC0299 | Human CXCL2 | Recombinant Protein | 20 ug |
| Proteins | PHC31109 | Human CXCL7 | Recombinant Protein | 20 ug |
| Proteins | PHC2679 | Human CYB5R2 | Recombinant Protein | 20 ug |
| Proteins | PHC31342 | Human Cyclin D2 | Recombinant Protein | 20 ug |
| Proteins | PHC32423 | Human Cyclin-Dependent Kinase 16 (CDK16) | Recombinant Protein | 20 ug |
| Proteins | PHC32169 | Human Cyclin-dependent Kinase 3 (CDK3) | Recombinant Protein | 10 ug |
| Proteins | PHC31724 | Human Cyclin-Dependent Kinase 4 (CDK4) | Recombinant Protein | 20 ug |
| Proteins | PHC30525 | Human Cyclin-H | Recombinant Protein | 20 ug |
| Proteins | PHC32277 | Human Cyclin-I (CCNI) | Recombinant Protein | 20 ug |
| Proteins | PHC30702 | Human Cyclophilin A (PPIA) | Recombinant Protein | 20 ug |
| Proteins | PHC0701 | Human Cyclophilin B | Recombinant Protein | 20 ug |
| Proteins | PHP0901 | Human Cyclophilin E | Recombinant Protein | 20 ug |
| Proteins | PHP30901 | Human Cyclophilin F (PPIF) | Recombinant Protein | 20 ug |
| Proteins | PHC30431 | Human Cyclophilin G (PPIG) | Recombinant Protein | 20 ug |
| Proteins | PHC30831 | Human Cyclophilin-40 (PPID) | Recombinant Protein | 20 ug |
| Proteins | PHC31333 | Human Cystathionase | Recombinant Protein | 20 ug |
| Proteins | PHC31531 | Human Cystatin S | Recombinant Protein | 20 ug |
| Proteins | PHC32117 | Human Cystatin-11 (CST11) | Recombinant Protein | 20 ug |
| Proteins | PHC31256 | Human Cystatin-9 (CST9) | Recombinant Protein | 20 ug |
| Proteins | PHC30983 | Human Cystatin-A (CSTA) | Recombinant Protein | 20 ug |
| Proteins | PHC33261 | Human Cystatin-A (CSTA) | Recombinant Protein | 10 ug |
| Proteins | PHC30841 | Human Cystatin-B (CSTB) | Recombinant Protein | 20 ug |
| Proteins | PHC32040 | Human Cystatin-C (CST3) | Recombinant Protein | 10 ug |
| Proteins | PHC33122 | Human Cystatin-D (CST5) | Recombinant Protein | 10 ug |
| Proteins | PHC33123 | Human Cystatin-F (CST7) | Recombinant Protein | 10 ug |
| Proteins | PHC33263 | Human Cystatin-M (CST6) | Recombinant Protein | 10 ug |
| Proteins | PHC33223 | Human Cystatin-S (CST4) | Recombinant Protein | 20 ug |
| Proteins | PHC31332 | Human Cystatin-SN (CST1) | Recombinant Protein | 20 ug |
| Proteins | PHC30393 | Human Cysteine Dioxygenase (CDO1) | Recombinant Protein | 20 ug |
| Proteins | PHC30739 | Human Cytidine Deaminase (CDA) | Recombinant Protein | 20 ug |
| Proteins | PHC32967 | Human CYTIP | Recombinant Protein | 20 ug |
| Proteins | PHC31178 | Human Cytochrome b5 | Recombinant Protein | 20 ug |
| Proteins | PHP3921 | Human Cytochrome P450 Reductase | Recombinant Protein | 10 ug |
| Proteins | PHC3105 | Human Cytohesin-1 | Recombinant Protein | 20 ug |
| Proteins | PHC1752 | Human Cytohesin-2 | Recombinant Protein | 20 ug |
| Proteins | PHK32599 | Human Cytokeratin-16 (CK-16) | Recombinant Protein | 20 ug |
| Proteins | PHC32580 | Human Cytokeratin-17 (CK-17) | Recombinant Protein | 20 ug |
| Proteins | PHC31939 | Human Cytokeratin-19 (CK-19) | Recombinant Protein | 20 ug |
| Proteins | PHK31960 | Human Cytokeratin-20 (CK-20) | Recombinant Protein | 20 ug |
| Proteins | PHC32640 | Human Cytokeratin-5 (CK-5) | Recombinant Protein | 20 ug |
| Proteins | PHC32076 | Human Cytokeratin-8 (CK-8) | Recombinant Protein | 20 ug |
| Proteins | PHC32849 | Human Cytosolic beta-Glucosidase (CBG, GBA3) | Recombinant Protein | 20 ug |
| Proteins | PHD30338 | Human D Amino Acid Oxidase | Recombinant Protein | 10 ug |
| Proteins | PHD31643 | Human DBNDD1 | Recombinant Protein | 20 ug |
| Proteins | PHD33055 | Human DcR1 | Recombinant Protein | 20 ug |
| Proteins | PHD31158 | Human DCUN1D2 | Recombinant Protein | 20 ug |
| Proteins | PHD0618 | Human DCXR | Recombinant Protein | 20 ug |
| Proteins | PHD30593 | Human DDT | Recombinant Protein | 20 ug |
| Proteins | PHD32358 | Human DDX56 | Recombinant Protein | 20 ug |
| Proteins | PHD32416 | Human Decoy Receptor 3 (DcR3) | Recombinant Protein | 20 ug |
| Proteins | PHD1204 | Human Density Regulated Protein | Recombinant Protein | 20 ug |
| Proteins | PHD30615 | Human Deoxycytidylate deaminase (DCTD) | Recombinant Protein | 20 ug |
| Proteins | PHD30901 | Human DHH | Recombinant Protein | 20 ug |
| Proteins | PHD30500 | Human DHPS | Recombinant Protein | 20 ug |
| Proteins | PHC31380 | Human Diaphorase 1 (CYB5R3) | Recombinant Protein | 20 ug |
| Proteins | PHA0567 | Human Diazepam Binding Inhibitor | Recombinant Protein | 20 ug |
| Proteins | PHD30371 | Human Dihydrofolate Reductase (DHFR) | Recombinant Protein | 20 ug |
| Proteins | PHD30754 | Human Dimethylarginine Dimethylaminohydrolase 1 (DDAH1) | Recombinant Protein | 20 ug |
| Proteins | PHD0428 | Human Dipeptidyl Peptidase IV (DPP4) | Recombinant Protein | 20 ug |
| Proteins | PHD31190 | Human DNA Polymerase beta | Recombinant Protein | 20 ug |
| Proteins | PHD31265 | Human DNAJB8 | Recombinant Protein | 20 ug |
| Proteins | PHD32338 | Human DNTTIP1 | Recombinant Protein | 20 ug |
| Proteins | PHD32595 | Human Docking Protein 4 (DOK4) | Recombinant Protein | 20 ug |
| Proteins | PHD0267 | Human DOPA Decarboxylase (DDC) | Recombinant Protein | 20 ug |
| Proteins | PHD32797 | Human DPY30 | Recombinant Protein | 20 ug |
| Proteins | PHD31596 | Human DSTN | Recombinant Protein | 20 ug |
| Proteins | PHD1114 | Human DTYMK | Recombinant Protein | 20 ug |
| Proteins | PHD31435 | Human Dual Specificity Protein Phosphatase 18 (DUSP18) | Recombinant Protein | 20 ug |
| Proteins | PHE32684 | Human Dual Specificity Protein Phosphatase 22 (DUSP22) | Recombinant Protein | 20 ug |
| Proteins | PHD32324 | Human Dual Specificity Protein Phosphatase 26 (DUSP26) | Recombinant Protein | 20 ug |
| Proteins | PHD1392 | Human DUSP10 | Recombinant Protein | 10 ug |
| Proteins | PHD31237 | Human DUSP3 | Recombinant Protein | 20 ug |
| Proteins | PHD31065 | Human Dynein light chain | Recombinant Protein | 20 ug |
| Proteins | PHD31968 | Human Dysadherin | Recombinant Protein | 20 ug |
| Proteins | PHD30278 | Human Dysbindin | Recombinant Protein | 20 ug |
| Proteins | PHL31717 | Human E3 Ubiquitin-Protein Ligase RNF181 | Recombinant Protein | 20 ug |
| Proteins | PHE32534 | Human EAF1 | Recombinant Protein | 10 ug |
| Proteins | PHE1213 | Human EB2 | Recombinant Protein | 20 ug |
| Proteins | PHE30901 | Human EBAG9 | Recombinant Protein | 20 ug |
| Proteins | PHE32329 | Human EBNA1BP2 | Recombinant Protein | 20 ug |
| Proteins | PHE30547 | Human EBP1 | Recombinant Protein | 20 ug |
| Proteins | PHE30711 | Human ECH1 | Recombinant Protein | 20 ug |
| Proteins | PHE31422 | Human ECHDC1 | Recombinant Protein | 20 ug |
| Proteins | PHE30703 | Human ECHS1 | Recombinant Protein | 20 ug |
| Proteins | PHE30655 | Human EDF1 | Recombinant Protein | 20 ug |
| Proteins | PHE32613 | Human EEF1A1 | Recombinant Protein | 20 ug |
| Proteins | PHE32357 | Human EIF3F | Recombinant Protein | 20 ug |
| Proteins | PHE32393 | Human EIF3S2 | Recombinant Protein | 20 ug |
| Proteins | PHE31334 | Human EIF4A3 | Recombinant Protein | 20 ug |
| Proteins | PHE32925 | Human ELAV-like Protein 2 (ELAVL2) | Recombinant Protein | 20 ug |
| Proteins | PHE32763 | Human Elongation Factor 1-gamma (EEF1G) | Recombinant Protein | 20 ug |
| Proteins | PHE32764 | Human Elongation Factor 2 (EF-2) | Recombinant Protein | 20 ug |
| Proteins | PHE32846 | Human Elongator Complex Protein 4 (ELP4) | Recombinant Protein | 20 ug |
| Proteins | PHE31617 | Human EMG1 | Recombinant Protein | 20 ug |
| Proteins | PHE32001 | Human Endothelin-2 | Recombinant Protein | 20 ug |
| Proteins | PHE30404 | Human Enolase 1 | Recombinant Protein | 20 ug |
| Proteins | PHE0801 | Human Enolase 2 | Recombinant Protein | 20 ug |
| Proteins | PHE32960 | Human Enterokinase | Recombinant Protein | 20 ug |
| Proteins | PHE30378 | Human Eotaxin-3 | Recombinant Protein | 20 ug |
| Proteins | PHE1279 | Human Ephrin A1 | Recombinant Protein | 20 ug |
| Proteins | PHE3886 | Human Ephrin A3 | Recombinant Protein | 10 ug |
| Proteins | PHE31193 | Human Ephrin B1 | Recombinant Protein | 20 ug |
| Proteins | PHE31658 | Human Ephrin B3 | Recombinant Protein | 20 ug |
| Proteins | PHE30501 | Human Epidermal Growth Factor (EGF) | Recombinant Protein | 20 ug |
| Proteins | PHE32923 | Human Epiregulin (EREG) | Recombinant Protein | 20 ug |
| Proteins | PHE32930 | Human ERGI3 | Recombinant Protein | 20 ug |
| Proteins | PHE30445 | Human ERK2 | Recombinant Protein | 20 ug |
| Proteins | PHE30462 | Human ERp57 | Recombinant Protein | 20 ug |
| Proteins | PHE32291 | Human Erythropoietin | Recombinant Protein | 10 ug |
| Proteins | PHE33252 | Human Erythropoietin Receptor (EPO-R) | Recombinant Protein | 10 ug |
| Proteins | PHE31864 | Human ESM1 | Recombinant Protein | 20 ug |
| Proteins | PHE30390 | Human Esterase D (ESD) | Recombinant Protein | 20 ug |
| Proteins | PHH32101 | Human Estradiol 17-beta-dehydrogenase 1 (HSD17B1) | Recombinant Protein | 10 ug |
| Proteins | PHE30284 | Human Estrogen Sulfotransferase (EST-1) | Recombinant Protein | 20 ug |
| Proteins | PHE30713 | Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) | Recombinant Protein | 20 ug |
| Proteins | PHE30963 | Human Eukaryotic Translation Initiation Factor 1B (EIF1B) | Recombinant Protein | 20 ug |
| Proteins | PHE30272 | Human Eukaryotic Translation Initiation Factor 5A Isoform B (eIF5A) | Recombinant Protein | 20 ug |
| Proteins | PF10118 | Human Factor alpha-XIIa (Factor 12a) | Purified Protein | 100 ug |
| Proteins | PF10096 | Human Factor IX (Factor 9) | Purified Protein | 0.1 mg |
| Proteins | PF10097 | Human Factor IXa Beta | Purified Protein | 0.1 mg |
| Proteins | PF25410 | Human Factor VII (Factor 7) | Purified Protein | 50 ug |
| Proteins | PF25418 | Human Factor VIIa (Activated Factor 7) | Purified Protein | 50 ug |
| Proteins | PF10102 | Human Factor X (Factor 10) | Purified Protein | 100 ug |
| Proteins | PF10106 | Human Factor Xa (Activated Factor 10) | Purified Protein | 100 ug |
| Proteins | PF10103 | Human Factor XI (Factor 11) | Purified Protein | 25 ug |
| Proteins | PF10105 | Human Factor XIa (Factor 11a) | Purified Protein | 25 ug |
| Proteins | PF10104 | Human Factor XII (Factor 12) | Purified Protein | 100 ug |
| Proteins | PF10107 | Human Factor XIII (Factor 13) | Purified Protein | 50 ug |
| Proteins | PF10109 | Human Factor XIIIa (Factor 13a) | Purified Protein | 50 ug |
| Proteins | PHF308012 | Human FADD | Recombinant Protein | 20 ug |
| Proteins | PHF32315 | Human FAM107B | Recombinant Protein | 20 ug |
| Proteins | PHF32428 | Human FANK1 | Recombinant Protein | 20 ug |
| Proteins | PHF31890 | Human Fas Ligand | Recombinant Protein | 20 ug |
| Proteins | PHF30662 | Human Fascin | Recombinant Protein | 20 ug |
| Proteins | PHF30701 | Human Fatty Acid-Binding Protein 1 (FABP1) | Recombinant Protein | 20 ug |
| Proteins | PHF30300 | Human Fatty Acid-Binding Protein 2 (FABP2) | Recombinant Protein | 20 ug |
| Proteins | PHA30294 | Human Fatty Acid-Binding Protein 3 (FABP3) | Recombinant Protein | 20 ug |
| Proteins | PHF30802 | Human Fatty Acid-Binding Protein 4 (FABP4) | Recombinant Protein | 20 ug |
| Proteins | PHF30805 | Human Fatty Acid-Binding Protein 5 (FABP5) | Recombinant Protein | 20 ug |
| Proteins | PHF30804 | Human Fatty Acid-Binding Protein 6 (FABP6) | Recombinant Protein | 20 ug |
| Proteins | PHF30801 | Human Fatty Acid-Binding Protein 7 (FABP7) | Recombinant Protein | 20 ug |
| Proteins | PHF31514 | Human Fatty Acid-Binding Protein 9 (FABP9) | Recombinant Protein | 20 ug |
| Proteins | PHF32459 | Human Fatty-Acid Amide Hydrolase 2 (FAAH2) | Recombinant Protein | 20 ug |
| Proteins | PHF30408 | Human FBP1 | Recombinant Protein | 20 ug |
| Proteins | PHF31808 | Human FBP2 | Recombinant Protein | 20 ug |
| Proteins | PHF33235 | Human FBP2 | Recombinant Protein | 10 ug |
| Proteins | PHF32168 | Human FBXO6 | Recombinant Protein | 20 ug |
| Proteins | PHF31880 | Human FDCSP | Recombinant Protein | 20 ug |
| Proteins | PF20031 | Human Ferritin | Purified Protein | 100 ug |
| Proteins | PHF0801 | Human Ferritin Light Chain | Recombinant Protein | 20 ug |
| Proteins | PA60111 | Human Fetuin-A (AHSG) | Purified Protein | 0.5 mg |
| Proteins | PHA32080 | Human Fetuin-A (AHSG) | Recombinant Protein | 10 ug |
| Proteins | PHF3094 | Human FGB (Fibrinogen beta Chain) | Recombinant Protein | 20 ug |
| Proteins | PHF30501 | Human FGF1 | Recombinant Protein | 20 ug |
| Proteins | PHF33786 | Human FGF2 | Recombinant Protein | 20 ug |
| Proteins | PHF32926 | Human FGFBP1 | Recombinant Protein | 10 ug |
| Proteins | PHF3899 | Human FGFR2 | Recombinant Protein | 10 ug |
| Proteins | PHF30563 | Human FHIT | Recombinant Protein | 20 ug |
| Proteins | PHF30902 | Human Fibroblast Growth Factor 12 (FGF-12) | Recombinant Protein | 20 ug |
| Proteins | PHA32092 | Human Fibroblast Growth Factor 17 (FGF-17) | Recombinant Protein | 20 ug |
| Proteins | PHF30901 | Human Fibroblast Growth Factor 2 (FGF-2) | Recombinant Protein | 20 ug |
| Proteins | PHF30905 | Human Fibroblast Growth Factor 21 (FGF-21) | Recombinant Protein | 20 ug |
| Proteins | PF10450 | Human Fibronectin (FN) | Purified Protein | 0.1 mg |
| Proteins | PHF30290 | Human FKBP12 | Recombinant Protein | 20 ug |
| Proteins | PHF30604 | Human FKBP14 | Recombinant Protein | 20 ug |
| Proteins | PHF31266 | Human FKBP1B | Recombinant Protein | 20 ug |
| Proteins | PHF30506 | Human FKBP2 | Recombinant Protein | 10 ug |
| Proteins | PHF30494 | Human FKBP25 | Recombinant Protein | 20 ug |
| Proteins | PHF30303 | Human FKBP4 | Recombinant Protein | 20 ug |
| Proteins | PHF0560 | Human FKBP6 | Recombinant Protein | 10 ug |
| Proteins | PHF33202 | Human FLRT3 | Recombinant Protein | 10 ug |
| Proteins | PHF31892 | Human FN3K-RP | Recombinant Protein | 20 ug |
| Proteins | PHF32938 | Human FOLR1 | Recombinant Protein | 20 ug |
| Proteins | PHF30448 | Human Frataxin | Recombinant Protein | 20 ug |
| Proteins | PHF0901 | Human FTH1 (Ferritin Heavy Chain) | Recombinant Protein | 20 ug |
| Proteins | PHF32902 | Human FUCA2 | Recombinant Protein | 20 ug |
| Proteins | PHF30915 | Human Fumarate Hydratase | Recombinant Protein | 20 ug |
| Proteins | PHF33028 | Human Furin | Recombinant Protein | 20 ug |
| Proteins | PHG31727 | Human G protein alpha Z | Recombinant Protein | 20 ug |
| Proteins | PHG34001 | Human G-CSF | Recombinant Protein | 10 ug |
| Proteins | PHG31344 | Human G3BP2 | Recombinant Protein | 20 ug |
| Proteins | PHG31533 | Human G6PD | Recombinant Protein | 20 ug |
| Proteins | PHG30465 | Human GABARAP | Recombinant Protein | 20 ug |
| Proteins | PHG309011 | Human GADD45B | Recombinant Protein | 20 ug |
| Proteins | PHG30902 | Human GADD45G | Recombinant Protein | 20 ug |
| Proteins | PHG32337 | Human GAGE2A | Recombinant Protein | 20 ug |
| Proteins | PHG32054 | Human Galanin (GAL) | Recombinant Protein | 10 ug |
| Proteins | PHG30614 | Human GALE | Recombinant Protein | 20 ug |
| Proteins | PHG31034 | Human Galectin 10 | Recombinant Protein | 20 ug |
| Proteins | PHG32493 | Human Galectin 13 | Recombinant Protein | 20 ug |
| Proteins | PHG30680 | Human Galectin 2 | Recombinant Protein | 20 ug |
| Proteins | PHG30688 | Human Galectin 8 | Recombinant Protein | 10 ug |
| Proteins | PHG30385 | Human Galectin-1 (Gal-1) | Recombinant Protein | 20 ug |
| Proteins | PHG30414 | Human Galectin-3 (Gal-3) | Recombinant Protein | 20 ug |
| Proteins | PHG30409 | Human Galectin-4 (Gal-4) | Recombinant Protein | 20 ug |
| Proteins | PHL30986 | Human Galectin-7 (Gal-7) | Recombinant Protein | 20 ug |
| Proteins | PHL31203 | Human Galectin-Related Protein (LGALSL) | Recombinant Protein | 20 ug |
| Proteins | PHL31981 | Human Galectin-related Protein (LGALSL) | Recombinant Protein | 10 ug |
| Proteins | PHG30641 | Human GALK1 | Recombinant Protein | 20 ug |
| Proteins | PHG30620 | Human GALM | Recombinant Protein | 20 ug |
| Proteins | PHG31529 | Human gamma C Crystallin | Recombinant Protein | 20 ug |
| Proteins | PHS32011 | Human Gamma-Synuclein | Recombinant Protein | 20 ug |
| Proteins | PHG30424 | Human GAMT | Recombinant Protein | 20 ug |
| Proteins | PHG0801 | Human GAPDH | Recombinant Protein | 20 ug |
| Proteins | PHG30295 | Human GAS7 | Recombinant Protein | 20 ug |
| Proteins | PHG32738 | Human GCHFR | Recombinant Protein | 20 ug |
| Proteins | PHG31657 | Human GCLM | Recombinant Protein | 20 ug |
| Proteins | PHG31281 | Human GCSH | Recombinant Protein | 20 ug |
| Proteins | PHG33027 | Human GDF-11 | Recombinant Protein | 20 ug |
| Proteins | PHG30410 | Human GDF-15 | Recombinant Protein | 20 ug |
| Proteins | PHT30657 | Human GDP-L-Fucose Synthase (TSTA3) | Recombinant Protein | 20 ug |
| Proteins | PHG30601 | Human Geminin | Recombinant Protein | 20 ug |
| Proteins | PHG32777 | Human GFPT1 | Recombinant Protein | 20 ug |
| Proteins | PHG30887 | Human GGCT | Recombinant Protein | 20 ug |
| Proteins | PHG30702 | Human GGPS1 | Recombinant Protein | 20 ug |
| Proteins | PHG30411 | Human Ghrelin | Recombinant Protein | 20 ug |
| Proteins | PHG3073 | Human GID8 | Recombinant Protein | 20 ug |
| Proteins | PHG31400 | Human GIPC2 | Recombinant Protein | 20 ug |
| Proteins | PHG31249 | Human GITR Ligand | Recombinant Protein | 20 ug |
| Proteins | PHG33088 | Human GITR Ligand | Recombinant Protein | 20 ug |
| Proteins | PHG30925 | Human Glia Maturation Factor-gamma (GMF-gamma) | Recombinant Protein | 20 ug |
| Proteins | PHG31149 | Human GLOD4 | Recombinant Protein | 20 ug |
| Proteins | PHG31139 | Human Glucagon (GCG) | Recombinant Protein | 20 ug |
| Proteins | PHH30702 | Human Glucokinase (Hexokinase-4) | Recombinant Protein | 20 ug |
| Proteins | PHG32838 | Human Glutamate Decarboxylase 1 (GAD1) | Recombinant Protein | 20 ug |
| Proteins | PHG32653 | Human Glutamate Dehydrogenase 1 (GDH 1) | Recombinant Protein | 20 ug |
| Proteins | PHG0625 | Human Glutamine Synthetase | Recombinant Protein | 20 ug |
| Proteins | PHG31399 | Human Glutamyl hydrolase gamma | Recombinant Protein | 20 ug |
| Proteins | PHG30904 | Human Glutaredoxin-1 (GLRX) | Recombinant Protein | 20 ug |
| Proteins | PHG30436 | Human Glutaredoxin-2 | Recombinant Protein | 20 ug |
| Proteins | PHG30551 | Human Glutaredoxin-3 | Recombinant Protein | 20 ug |
| Proteins | PHG31273 | Human Glutathione Peroxidase 1 (GPX1) | Recombinant Protein | 20 ug |
| Proteins | PHG31429 | Human Glutathione Peroxidase 3 / GPx-3 | Recombinant Protein | 10 ug |
| Proteins | PHG31391 | Human Glutathione Peroxidase 7 (GPX7) | Recombinant Protein | 20 ug |
| Proteins | PHG31318 | Human Glutathione Reductase | Recombinant Protein | 10 ug |
| Proteins | PHG31464 | Human Glutathione S Transferase theta 2 | Recombinant Protein | 20 ug |
| Proteins | PHG30491 | Human Glutathione S-Transferase Zeta 1 (GSTZ1) | Recombinant Protein | 20 ug |
| Proteins | PHG30776 | Human Glutathione Synthetase (GSS) | Recombinant Protein | 20 ug |
| Proteins | PHG32551 | Human GLYATL2 | Recombinant Protein | 10 ug |
| Proteins | PHG30486 | Human Glycerol 3 Phosphate Dehydrogenase (GPD1) | Recombinant Protein | 20 ug |
| Proteins | PHG32082 | Human Glycine Acetyltransferase (GCAT) | Recombinant Protein | 20 ug |
| Proteins | PHG32756 | Human Glycyl-tRNA Synthetase (GARS) | Recombinant Protein | 20 ug |
| Proteins | PHG30915 | Human Glyoxalase I | Recombinant Protein | 20 ug |
| Proteins | PHG30501 | Human GM-CSF | Recombinant Protein | 20 ug |
| Proteins | PHG32363 | Human GM-CSF Receptor alpha | Recombinant Protein | 20 ug |
| Proteins | PHG1282 | Human GMDS | Recombinant Protein | 20 ug |
| Proteins | PHG30681 | Human GMF beta | Recombinant Protein | 20 ug |
| Proteins | PHG31410 | Human GMPR1 | Recombinant Protein | 20 ug |
| Proteins | PHG2533 | Human GNG11 | Recombinant Protein | 20 ug |
| Proteins | PHG330011 | Human GNG12 | Recombinant Protein | 20 ug |
| Proteins | PHG32815 | Human GNGT1 | Recombinant Protein | 20 ug |
| Proteins | PHG0901 | Human GNMT | Recombinant Protein | 20 ug |
| Proteins | PHG30701 | Human GNPDA 1 | Recombinant Protein | 20 ug |
| Proteins | PHG32973 | Human Golgi Phosphoprotein 6 (GORASP2) | Recombinant Protein | 20 ug |
| Proteins | PHG30485 | Human Golgi-associated PDZ and Coiled-coil Motif-containing Protein (GOPC) | Recombinant Protein | 20 ug |
| Proteins | PHG1214 | Human GPD1L | Recombinant Protein | 20 ug |
| Proteins | PG52412 | Human GPIIbIIIa | Purified Protein | 100 ug |
| Proteins | PHC34001 | Human Granulocyte-Colony Stimulating Factor (G-CSF) | Recombinant Protein | 20 ug |
| Proteins | PHM30501 | Human Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF) | Recombinant Protein | 20 ug |
| Proteins | PHG32978 | Human Granzyme B (GZMB) | Recombinant Protein | 20 ug |
| Proteins | PHG32294 | Human Granzyme K (GZMK) | Recombinant Protein | 20 ug |
| Proteins | PHG30286 | Human GRB2 | Recombinant Protein | 20 ug |
| Proteins | PHG32049 | Human Gremlin-2 (GREM2) | Recombinant Protein | 20 ug |
| Proteins | PHG30577 | Human GRHPR | Recombinant Protein | 20 ug |
| Proteins | PHG30336 | Human Growth Differentiation Factor 10 (GDF-10) | Recombinant Protein | 20 ug |
| Proteins | PHG30334 | Human Growth Differentiation Factor 5 (GDF-5) | Recombinant Protein | 20 ug |
| Proteins | PHG33002 | Human Growth Hormone | Recombinant Protein | 20 ug |
| Proteins | PHG33001 | Human Growth Hormone (GH) | Recombinant Protein | 20 ug |
| Proteins | PHG33207 | Human Growth hormone receptor | Recombinant Protein | 10 ug |
| Proteins | PHG30901 | Human GRP75 | Recombinant Protein | 20 ug |
| Proteins | PHH0901 | Human GRP78 | Recombinant Protein | 20 ug |
| Proteins | PHG32212 | Human GRP78 | Recombinant Protein | 20 ug |
| Proteins | PHG30443 | Human GSTA1 | Recombinant Protein | 20 ug |
| Proteins | PHG31504 | Human GSTA4 | Recombinant Protein | 20 ug |
| Proteins | PHG30464 | Human GSTK1 | Recombinant Protein | 20 ug |
| Proteins | PHG30728 | Human GSTM2 | Recombinant Protein | 20 ug |
| Proteins | PHG31463 | Human GSTM3 | Recombinant Protein | 20 ug |
| Proteins | PHG0649 | Human GSTM4 | Recombinant Protein | 20 ug |
| Proteins | PHG31597 | Human GSTM5 | Recombinant Protein | 20 ug |
| Proteins | PHG30341 | Human GSTP1 | Recombinant Protein | 20 ug |
| Proteins | PHG0346 | Human GSTT1 | Recombinant Protein | 20 ug |
| Proteins | PHG30449 | Human GTF2B | Recombinant Protein | 20 ug |
| Proteins | PHG30516 | Human GTPase HRAS | Recombinant Protein | 20 ug |
| Proteins | PHG31660 | Human GTPBP9 | Recombinant Protein | 20 ug |
| Proteins | PHG32630 | Human GTSF1 | Recombinant Protein | 20 ug |
| Proteins | PHG31922 | Human Guanine Deaminase (GDA) | Recombinant Protein | 20 ug |
| Proteins | PHH305012 | Human HADHSC | Recombinant Protein | 20 ug |
| Proteins | PHH1739 | Human HAND1 | Recombinant Protein | 20 ug |
| Proteins | PHH1168 | Human HAO-1 | Recombinant Protein | 20 ug |
| Proteins | PH30011 | Human Haptoglobin (Mixed Type) | Purified Protein | 1 mg |
| Proteins | PHH32581 | Human Haptoglobin-Related Protein (HPR) | Recombinant Protein | 10 ug |
| Proteins | PHH30337 | Human Harmonin (USH1C) | Recombinant Protein | 20 ug |
| Proteins | PHH32210 | Human HB-EGF | Recombinant Protein | 10 ug |
| Proteins | PHH31927 | Human HBG2 | Recombinant Protein | 20 ug |
| Proteins | PHH31650 | Human HBXIP | Recombinant Protein | 20 ug |
| Proteins | PHH30528 | Human HBZ | Recombinant Protein | 20 ug |
| Proteins | PHH32896 | Human HDDC2 | Recombinant Protein | 20 ug |
| Proteins | PHH31267 | Human HDDC3 | Recombinant Protein | 20 ug |
| Proteins | PHH31366 | Human HDGFRP3 | Recombinant Protein | 20 ug |
| Proteins | PHH30818 | Human HDHD2 | Recombinant Protein | 20 ug |
| Proteins | PHH40701 | Human Heat Shock 40 kDa Protein (HSP40) | Recombinant Protein | 20 ug |
| Proteins | PHH30428 | Human Heat Shock 70 kDa Protein B (HSP70B) | Recombinant Protein | 20 ug |
| Proteins | PHH32784 | Human Heat Shock Factor 2-Binding Protein (HSF2BP) | Recombinant Protein | 20 ug |
| Proteins | PHH33001 | Human Heat Shock Factor Binding Protein 1 (HSBP1) | Recombinant Protein | 20 ug |
| Proteins | PHF30831 | Human Heat Shock Factor Protein 1 (HSF 1) | Recombinant Protein | 20 ug |
| Proteins | PHH30801 | Human Heat Shock Protein 10 (HSP10) | Recombinant Protein | 20 ug |
| Proteins | PHH30803 | Human Heat Shock Protein 105a (HSP105a) | Recombinant Protein | 20 ug |
| Proteins | PHH30503 | Human Heat Shock Protein 27 (HSP27) | Recombinant Protein | 20 ug |
| Proteins | PHH30904 | Human Heat Shock Protein 47 (HSP47) | Recombinant Protein | 20 ug |
| Proteins | PHH30802 | Human Heat Shock Protein 60 (HSP60) | Recombinant Protein | 20 ug |
| Proteins | PHH30603 | Human Heat Shock Protein 70 (HSP70) | Recombinant Protein | 20 ug |
| Proteins | PHH30971 | Human Heat Shock Protein 70kDa Family Member 13 (HSPA13) | Recombinant Protein | 20 ug |
| Proteins | PHH30501 | Human Heat Shock Protein 90 (HSP90) | Recombinant Protein | 20 ug |
| Proteins | PHH31549 | Human Heat Shock Protein beta-2 (HSPB2) | Recombinant Protein | 20 ug |
| Proteins | PHH31202 | Human Heat Shock Protein beta-3 (HSPB3) | Recombinant Protein | 20 ug |
| Proteins | PHH30493 | Human Heat Shock Protein beta-8 (HSPB8) | Recombinant Protein | 10 ug |
| Proteins | PHH32475 | Human Heat Shock Transcription Factor Y-linked 1 (HSFY1) | Recombinant Protein | 20 ug |
| Proteins | PHH30901 | Human Heme Oxygenase 1 (HO-1) | Recombinant Protein | 20 ug |
| Proteins | PHH30470 | Human Heme Oxygenase 2 (HO-2) | Recombinant Protein | 20 ug |
| Proteins | PHH31677 | Human Hemoglobin subunit alpha | Recombinant Protein | 20 ug |
| Proteins | PH30021 | Human Hemopexin | Purified Protein | 0.2 mg |
| Proteins | PHH32561 | Human Hemopexin | Recombinant Protein | 20 ug |
| Proteins | PHH30402 | Human Hepatoma-Derived Growth Factor (HDGF) | Recombinant Protein | 20 ug |
| Proteins | PHH30704 | Human Hexokinase-1 | Recombinant Protein | 20 ug |
| Proteins | PHH30703 | Human Hexokinase-2 | Recombinant Protein | 20 ug |
| Proteins | PHH30701 | Human Hexokinase-3 | Recombinant Protein | 20 ug |
| Proteins | PHH2718 | Human HGF | Recombinant Protein | 20 ug |
| Proteins | PHH305011 | Human HIF-1 alpha | Recombinant Protein | 20 ug |
| Proteins | PHH309041 | Human HIF1AN | Recombinant Protein | 20 ug |
| Proteins | PL50031 | Human High Density Lipoprotein (HDL) | Purified Protein | 1 mg |
| Proteins | PHH30811 | Human High Mobility Group B1 (HMGB1) | Recombinant Protein | 20 ug |
| Proteins | PHH30511 | Human High Temperature Requirement Protein A2 (HtrA2/Omi) | Recombinant Protein | 20 ug |
| Proteins | PHH30327 | Human HINT1 | Recombinant Protein | 20 ug |
| Proteins | PHH30905 | Human HIP | Recombinant Protein | 20 ug |
| Proteins | PHH32083 | Human Histone H3.3 (H3F3A) | Recombinant Protein | 20 ug |
| Proteins | PHH32683 | Human HLA-DOB | Recombinant Protein | 20 ug |
| Proteins | PHH31433 | Human HMBS | Recombinant Protein | 20 ug |
| Proteins | PHH32238 | Human HMGB3 | Recombinant Protein | 20 ug |
| Proteins | PHH32796 | Human HMGN3 | Recombinant Protein | 20 ug |
| Proteins | PHH30273 | Human HNMT | Recombinant Protein | 20 ug |
| Proteins | PHH32190 | Human HNRNPK | Recombinant Protein | 20 ug |
| Proteins | PHH31639 | Human HOPX | Recombinant Protein | 20 ug |
| Proteins | PHH30585 | Human HPRT1 | Recombinant Protein | 20 ug |
| Proteins | PHH309011 | Human HRASLS3 | Recombinant Protein | 20 ug |
| Proteins | PHH2850 | Human HSBP1L1 | Recombinant Protein | 20 ug |
| Proteins | PHH33008 | Human HSP20 | Recombinant Protein | 10 ug |
| Proteins | PHH0276 | Human HSP90B1 | Recombinant Protein | 20 ug |
| Proteins | PHH30554 | Human HSPBP1 | Recombinant Protein | 10 ug |
| Proteins | PHH30529 | Human HSPC150 | Recombinant Protein | 20 ug |
| Proteins | PHG1007 | Human HSPC210 | Recombinant Protein | 20 ug |
| Proteins | PHI31006 | Human IBA1 | Recombinant Protein | 20 ug |
| Proteins | PHI33030 | Human ICAM-1 | Recombinant Protein | 10 ug |
| Proteins | PHI3931 | Human ICAM-3 | Recombinant Protein | 10 ug |
| Proteins | PHI30601 | Human ICAT | Recombinant Protein | 20 ug |
| Proteins | PHI31834 | Human ICT1 | Recombinant Protein | 20 ug |
| Proteins | PHI31284 | Human IDH1 | Recombinant Protein | 20 ug |
| Proteins | PHI3894 | Human IFN-alpha/beta R1 (IFNAR1) | Recombinant Protein | 10 ug |
| Proteins | PHI31722 | Human IFT20 | Recombinant Protein | 20 ug |
| Proteins | PHI32991 | Human IGFBP-3 | Recombinant Protein | 20 ug |
| Proteins | PHI31998 | Human IGLL1 | Recombinant Protein | 20 ug |
| Proteins | PHI32305 | Human IkB-delta | Recombinant Protein | 20 ug |
| Proteins | PHI33044 | Human IL-1F10 | Recombinant Protein | 20 ug |
| Proteins | PHI32819 | Human IL-36RN | Recombinant Protein | 20 ug |
| Proteins | PHI307012 | Human IL1 beta | Recombinant Protein | 20 ug |
| Proteins | PHI33069 | Human IL2 Receptor Gamma (IL2RG) | Recombinant Protein | 10 ug |
| Proteins | PHI33182 | Human IL21 Receptor | Recombinant Protein | 10 ug |
| Proteins | PHI32800 | Human IMMP2L | Recombinant Protein | 20 ug |
| Proteins | PI50011 | Human Immunoglobulin A (IgA) | Purified Protein | 0.5 mg |
| Proteins | PI50012 | Human Immunoglobulin A1 (IgA1) | Purified Protein | 0.5 mg |
| Proteins | PI50013 | Human Immunoglobulin A2 (IgA2) | Purified Protein | 0.5 mg |
| Proteins | PHB30901 | Human Immunoglobulin Binding Protein (BiP) | Recombinant Protein | 20 ug |
| Proteins | PI50014 | Human Immunoglobulin D (IgD) | Purified Protein | 20 ug |
| Proteins | PI50015 | Human Immunoglobulin E (IgE) | Purified Protein | 20 ug |
| Proteins | PI50016 | Human Immunoglobulin G1 (IgG1) | Purified Protein | 0.5 mg |
| Proteins | PI50017 | Human Immunoglobulin G2 (IgG2) | Purified Protein | 0.5 mg |
| Proteins | PI50018 | Human Immunoglobulin G3 (IgG3) | Purified Protein | 0.5 mg |
| Proteins | PHI32039 | Human Immunoglobulin J Chain (IGJ) | Recombinant Protein | 20 ug |
| Proteins | PI50022 | Human Immunoglobulin M (IgM) | Purified Protein | 0.2 mg |
| Proteins | PI50023 | Human Immunoglobulin M (IgM) | Purified Protein | 1 mg |
| Proteins | PI50024 | Human Immunoglobulin M (IgM) | Purified Protein | 5 mg |
| Proteins | PHI31920 | Human IMP3 | Recombinant Protein | 20 ug |
| Proteins | PHI30737 | Human IMPA1 | Recombinant Protein | 20 ug |
| Proteins | PHI31889 | Human IMPAD1 | Recombinant Protein | 20 ug |
| Proteins | PHI32311 | Human INCA | Recombinant Protein | 20 ug |
| Proteins | PHI32891 | Human Inhibitor of Growth Protein 1 (ING1) | Recombinant Protein | 20 ug |
| Proteins | PHI0639 | Human Inosine Triphosphate Pyrophosphatase | Recombinant Protein | 20 ug |
| Proteins | PHI30511 | Human Insulin-like Growth Factor-1 (IGF-1) | Recombinant Protein | 20 ug |
| Proteins | PHI32484 | Human Integrin beta-1 (ITGB1) | Recombinant Protein | 20 ug |
| Proteins | PHI36824 | Human Inter Alpha Inhibitor Proteins (IAIP) | Purified Protein | 25 ug |
| Proteins | PHI31500 | Human Interferon alpha-14 (IFN-alpha-14) | Recombinant Protein | 20 ug |
| Proteins | PHI30502 | Human Interferon alpha-2b | Recombinant Protein | 20 ug |
| Proteins | PHI30703 | Human Interferon Regulatory Factor 2 (IRF-2) | Recombinant Protein | 20 ug |
| Proteins | PHI30501 | Human Interferon-alpha 1 (IFN-alpha-1/13) | Recombinant Protein | 20 ug |
| Proteins | PHI31493 | Human Interferon-gamma (IFN-gamma) | Recombinant Protein | 20 ug |
| Proteins | PHI34001 | Human Interferon-gamma (IFN-gamma) | Recombinant Protein | 20 ug |
| Proteins | PHI0801 | Human Interleukin-1 alpha (IL-1 alpha) | Recombinant Protein | 10 ug |
| Proteins | PHI30801 | Human Interleukin-1 alpha (IL-1 alpha) | Recombinant Protein | 10 ug |
| Proteins | PHI30701 | Human Interleukin-1 beta (IL-1-beta) | Recombinant Protein | 20 ug |
| Proteins | PHI30904 | Human Interleukin-10 (IL-10) | Recombinant Protein | 20 ug |
| Proteins | PHI30711 | Human Interleukin-15 (IL-15) | Recombinant Protein | 20 ug |
| Proteins | PHI33017 | Human Interleukin-16 (IL-16) | Recombinant Protein | 10 ug |
| Proteins | PHI33083 | Human Interleukin-17A (IL-17A) | Recombinant Protein | 10 ug |
| Proteins | PHI32215 | Human Interleukin-17F (IL-17F) | Recombinant Protein | 20 ug |
| Proteins | PHI30541 | Human Interleukin-18 (IL-18) | Recombinant Protein | 20 ug |
| Proteins | PHI305011 | Human Interleukin-18 (IL-18) | Recombinant Protein | 20 ug |
| Proteins | PHI31940 | Human Interleukin-18 Binding Protein (IL-18BP) | Recombinant Protein | 20 ug |
| Proteins | PHI30531 | Human Interleukin-2 (IL-2) | Recombinant Protein | 20 ug |
| Proteins | PHI309041 | Human Interleukin-25 (IL-25) | Recombinant Protein | 20 ug |
| Proteins | PHL32955 | Human Interleukin-29 (IL-29) | Recombinant Protein | 20 ug |
| Proteins | PHI30702 | Human Interleukin-3 (IL-3) | Recombinant Protein | 20 ug |
| Proteins | PHI30266 | Human Interleukin-32 (IL-32) | Recombinant Protein | 20 ug |
| Proteins | PHI30721 | Human Interleukin-33 (IL-33) | Recombinant Protein | 20 ug |
| Proteins | PHI31990 | Human Interleukin-34 (IL-34) | Recombinant Protein | 10 ug |
| Proteins | PHI2236 | Human Interleukin-36 gamma | Recombinant Protein | 20 ug |
| Proteins | PHI30905 | Human Interleukin-4 (IL-4) | Recombinant Protein | 10 ug |
| Proteins | PHI30352 | Human Interleukin-6 | Recombinant Protein | 20 ug |
| Proteins | PHI30521 | Human Interleukin-8 (IL-8) | Recombinant Protein | 20 ug |
| Proteins | PHI32965 | Human Interleukin-9 (IL-9) | Recombinant Protein | 10 ug |
| Proteins | PHI33002 | Human IPP | Recombinant Protein | 20 ug |
| Proteins | PHI307021 | Human IRF1 | Recombinant Protein | 20 ug |
| Proteins | PHI0701 | Human IRF3 | Recombinant Protein | 20 ug |
| Proteins | PHI31833 | Human IRGM | Recombinant Protein | 20 ug |
| Proteins | PHI31655 | Human ITPK1 | Recombinant Protein | 20 ug |
| Proteins | PHI30487 | Human IVD | Recombinant Protein | 20 ug |
| Proteins | PHJ32487 | Human Janus Kinase 2 (JAK-2) | Recombinant Protein | 20 ug |
| Proteins | PHJ33120 | Human JNK1 | Recombinant Protein | 20 ug |
| Proteins | PHJ31649 | Human JNK2 | Recombinant Protein | 20 ug |
| Proteins | PHJ1756 | Human Josephin-1 (JOSD1) | Recombinant Protein | 20 ug |
| Proteins | PHJ31874 | Human Junctional Adhesion Molecule 2/JAM-B | Recombinant Protein | 20 ug |
| Proteins | PK20031 | Human Kallikrein | Purified Protein | 100 ug |
| Proteins | PHK32664 | Human Kallikrein-10 (KLK10) | Recombinant Protein | 20 ug |
| Proteins | PHK32773 | Human Kallikrein-11 (KLK11) | Recombinant Protein | 20 ug |
| Proteins | PHK32558 | Human Kallikrein-15 (KLK15) | Recombinant Protein | 20 ug |
| Proteins | PHK32175 | Human Kallikrein-2 (KLK2) | Recombinant Protein | 20 ug |
| Proteins | PHK1566 | Human Kallikrein-3 (KLK3) | Recombinant Protein | 20 ug |
| Proteins | PHK3926 | Human Kallikrein-3 (KLK3) | Recombinant Protein | 10 ug |
| Proteins | PHK1737 | Human Kallikrein-7 (KLK7) | Recombinant Protein | 20 ug |
| Proteins | PHK1182 | Human KAT2A/GCN5L2 | Recombinant Protein | 20 ug |
| Proteins | PHK31893 | Human KCTD15 | Recombinant Protein | 20 ug |
| Proteins | PHK30437 | Human Ketohexokinase | Recombinant Protein | 20 ug |
| Proteins | PHK33034 | Human KIM-1 | Recombinant Protein | 20 ug |
| Proteins | PHK31797 | Human KIN | Recombinant Protein | 20 ug |
| Proteins | PK20011 | Human Kininogen (HMW) | Purified Protein | 100 ug |
| Proteins | PK20021 | Human Kininogen (LMW) | Purified Protein | 100 ug |
| Proteins | PHK33002 | Human KIR2DL3 | Recombinant Protein | 20 ug |
| Proteins | PHK33003 | Human KIR2DS4 | Recombinant Protein | 20 ug |
| Proteins | PHK30901 | Human Kisspeptin-1 (KISS1) | Recombinant Protein | 20 ug |
| Proteins | PHK32174 | Human KLF7 | Recombinant Protein | 20 ug |
| Proteins | PHK1738 | Human KLRC3 | Recombinant Protein | 20 ug |
| Proteins | PHK32325 | Human KRAB-associated Protein 1 (KAP-1) | Recombinant Protein | 20 ug |
| Proteins | PHK0609 | Human KRAS | Recombinant Protein | 20 ug |
| Proteins | PHK32825 | Human Krueppel-Like Factor 12 (KLF12) | Recombinant Protein | 20 ug |
| Proteins | PHK32249 | Human Krueppel-like Factor 3 (KLF3) | Recombinant Protein | 20 ug |
| Proteins | PHK33009 | Human Krueppel-like Factor 4 (KLF4) | Recombinant Protein | 20 ug |
| Proteins | PHL30616 | Human L-lactate Dehydrogenase B Chain (LDHB) | Recombinant Protein | 20 ug |
| Proteins | PL50011 | Human Lactoferrin | Purified Protein | 50 ug |
| Proteins | PL50012 | Human Lactoferrin | Purified Protein | 200 ug |
| Proteins | PHL32736 | Human LanC-like Protein 1 (LANCL1) | Recombinant Protein | 20 ug |
| Proteins | PHL33047 | Human Langerin | Recombinant Protein | 20 ug |
| Proteins | PHL33029 | Human LAP3 | Recombinant Protein | 20 ug |
| Proteins | PHL30277 | Human Latexin | Recombinant Protein | 20 ug |
| Proteins | PHL31346 | Human LCMT1 | Recombinant Protein | 20 ug |
| Proteins | PHL30488 | Human LDHA | Recombinant Protein | 20 ug |
| Proteins | PHL31629 | Human LDOC1L | Recombinant Protein | 20 ug |
| Proteins | PHL33002 | Human Leptin | Recombinant Protein | 20 ug |
| Proteins | PHL23104 | Human Leucine-rich Alpha-2-Glycoprotein (LRG1) | Purified Protein | 20 ug |
| Proteins | PHL32295 | Human Leucine-rich Alpha-2-Glycoprotein (LRG1) | Recombinant Protein | 20 ug |
| Proteins | PHL32310 | Human Leukosialin | Recombinant Protein | 20 ug |
| Proteins | PHL31837 | Human LIN7C | Recombinant Protein | 20 ug |
| Proteins | PHL32626 | Human LIPG | Recombinant Protein | 20 ug |
| Proteins | PHL30505 | Human Lipoamide Dehydrogenase | Recombinant Protein | 20 ug |
| Proteins | PHL32816 | Human Lipocalin-1 (LCN1) | Recombinant Protein | 20 ug |
| Proteins | PA20101 | Human Lipoprotein a [Lp(a)] | Purified Protein | 50 ug |
| Proteins | PHL30801 | Human Livin (BIRC7) | Recombinant Protein | 20 ug |
| Proteins | LL37P | Human LL - 37, Antibacterial Peptide | Peptide | 100 ug |
| Proteins | PL50051 | Human Low Density Lipoprotein (LDL) | Purified Protein | 1 mg |
| Proteins | PHL32831 | Human LOX | Recombinant Protein | 20 ug |
| Proteins | PHL31199 | Human LOX-1 | Recombinant Protein | 20 ug |
| Proteins | PHL31946 | Human LPS-induced TNF-alpha Factor (LITAF) | Recombinant Protein | 20 ug |
| Proteins | PHL32971 | Human LRP2BP | Recombinant Protein | 20 ug |
| Proteins | PHL30734 | Human LSM1 | Recombinant Protein | 20 ug |
| Proteins | PHL32491 | Human Lumican | Recombinant Protein | 20 ug |
| Proteins | PHL30316 | Human Lymphotactin | Recombinant Protein | 10 ug |
| Proteins | PHL31918 | Human LYN | Recombinant Protein | 20 ug |
| Proteins | PHL31646 | Human LYPLAL1 | Recombinant Protein | 20 ug |
| Proteins | PL50071 | Human Lysozyme | Purified Protein | 50 ug |
| Proteins | PHL31166 | Human LysRS | Recombinant Protein | 20 ug |
| Proteins | PHL32506 | Human LZIC | Recombinant Protein | 20 ug |
| Proteins | PHM30432 | Human Macrophage Colony Stimulating Factor (MCSF) | Recombinant Protein | 20 ug |
| Proteins | PHM30580 | Human Macrophage Inflammatory Protein 3 beta | Recombinant Protein | 20 ug |
| Proteins | PHM31012 | Human Macrophage inflammatory protein 5 | Recombinant Protein | 20 ug |
| Proteins | PHM30511 | Human Macrophage Migration Inhibitory Factor (MIF) | Recombinant Protein | 20 ug |
| Proteins | PHM30594 | Human MAGEA4 | Recombinant Protein | 20 ug |
| Proteins | PHM30823 | Human Magnesium-dependent phosphatase 1 (MDP1) | Recombinant Protein | 20 ug |
| Proteins | PHM30538 | Human MAGOH | Recombinant Protein | 20 ug |
| Proteins | PHM31995 | Human Malignant T cell amplified sequence 1 | Recombinant Protein | 20 ug |
| Proteins | PHM31812 | Human Mannose-binding Lectin 2 (MBL2) | Recombinant Protein | 20 ug |
| Proteins | PHM30656 | Human MAP1LC3A | Recombinant Protein | 20 ug |
| Proteins | PHM31039 | Human MAP1LC3B2 | Recombinant Protein | 20 ug |
| Proteins | PHM30805 | Human MAP2K1IP1 | Recombinant Protein | 20 ug |
| Proteins | PHM32464 | Human MAP3K12 binding inhibitory protein 1 | Recombinant Protein | 20 ug |
| Proteins | PHM31313 | Human MAPK12 | Recombinant Protein | 20 ug |
| Proteins | PHM1285 | Human MAPK13 (p38 delta) | Recombinant Protein | 20 ug |
| Proteins | PHM1300 | Human MAPK14 (p38 alpha) | Recombinant Protein | 20 ug |
| Proteins | PHM31805 | Human MAPKAP Kinase 3 | Recombinant Protein | 20 ug |
| Proteins | PHM309012 | Human MAT2A | Recombinant Protein | 20 ug |
| Proteins | PHM2542 | Human Matrix Metalloproteinase-1 (MMP-1) | Recombinant Protein | 20 ug |
| Proteins | PHM2537 | Human Matrix Metalloproteinase-10 (MMP-10) | Recombinant Protein | 20 ug |
| Proteins | PHM2547 | Human Matrix Metalloproteinase-2 (MMP-2) | Recombinant Protein | 10 ug |
| Proteins | PHM32660 | Human Matrix Metalloproteinase-23 (MMP-23) | Recombinant Protein | 20 ug |
| Proteins | PHM32546 | Human Matrix Metalloproteinase-28 (MMP-28) | Recombinant Protein | 20 ug |
| Proteins | PHM33067 | Human Matrix Metalloproteinase-7 (MMP-7) | Recombinant Protein | 20 ug |
| Proteins | PHM2543 | Human Matrix Metalloproteinase-8 (MMP-8) | Recombinant Protein | 20 ug |
| Proteins | PHM30539 | Human MAX | Recombinant Protein | 20 ug |
| Proteins | PHM30752 | Human MCEE | Recombinant Protein | 20 ug |
| Proteins | PHM32217 | Human MD-1 | Recombinant Protein | 20 ug |
| Proteins | PHM30665 | Human MDH1 | Recombinant Protein | 20 ug |
| Proteins | PHT31855 | Human MED20 | Recombinant Protein | 20 ug |
| Proteins | PHM32582 | Human Melanoregulin (MREG) | Recombinant Protein | 20 ug |
| Proteins | PHM31619 | Human MEMO1 | Recombinant Protein | 20 ug |
| Proteins | PHM32657 | Human MESDC1 | Recombinant Protein | 20 ug |
| Proteins | PHS32593 | Human Metalloreductase STEAP4 | Recombinant Protein | 20 ug |
| Proteins | PHM1509 | Human METAP1 | Recombinant Protein | 20 ug |
| Proteins | PHM32903 | Human METTL21D | Recombinant Protein | 20 ug |
| Proteins | PHM31933 | Human Mevalonate Kinase (MVK) | Recombinant Protein | 20 ug |
| Proteins | PHM31707 | Human MFAP4 | Recombinant Protein | 20 ug |
| Proteins | PHM32614 | Human MGAT2 | Recombinant Protein | 20 ug |
| Proteins | PHM33101 | Human MIF | Recombinant Protein | 20 ug |
| Proteins | PHM31721 | Human MitoNEET | Recombinant Protein | 20 ug |
| Proteins | PHM31206 | Human MLC1SA | Recombinant Protein | 20 ug |
| Proteins | PHM32721 | Human MLLT11 | Recombinant Protein | 20 ug |
| Proteins | PHM30677 | Human MMAB | Recombinant Protein | 20 ug |
| Proteins | PHM30642 | Human MMS2 | Recombinant Protein | 20 ug |
| Proteins | PHM32026 | Human MOB4A | Recombinant Protein | 20 ug |
| Proteins | PHM31620 | Human MOG1 | Recombinant Protein | 20 ug |
| Proteins | PHM31494 | Human MORF4L1 | Recombinant Protein | 20 ug |
| Proteins | PHM30987 | Human Mortality Factor 4 like 2 | Recombinant Protein | 20 ug |
| Proteins | PHM31192 | Human MPI | Recombinant Protein | 20 ug |
| Proteins | PHM31163 | Human MRCL3 | Recombinant Protein | 20 ug |
| Proteins | PHM32569 | Human MRFAP1L1 | Recombinant Protein | 20 ug |
| Proteins | PHM33038 | Human MRM3 | Recombinant Protein | 20 ug |
| Proteins | PHM30524 | Human MRP8 | Recombinant Protein | 20 ug |
| Proteins | PHM31826 | Human MRRF | Recombinant Protein | 20 ug |
| Proteins | PHM30813 | Human MSRB2 | Recombinant Protein | 20 ug |
| Proteins | PHM31860 | Human MST | Recombinant Protein | 20 ug |
| Proteins | PHM32535 | Human MT3 | Recombinant Protein | 20 ug |
| Proteins | PHM32402 | Human MTCP1 | Recombinant Protein | 20 ug |
| Proteins | PHM30742 | Human MTH1 | Recombinant Protein | 20 ug |
| Proteins | PHM32972 | Human MTHFD2 | Recombinant Protein | 20 ug |
| Proteins | PHM30976 | Human MTHFS | Recombinant Protein | 20 ug |
| Proteins | PHM32935 | Human MTHFSD | Recombinant Protein | 20 ug |
| Proteins | PHM30559 | Human mu Crystallin | Recombinant Protein | 20 ug |
| Proteins | PHM31894 | Human MyD88 | Recombinant Protein | 20 ug |
| Proteins | PHM32348 | Human Myelin Basic Protein (MBP) | Recombinant Protein | 20 ug |
| Proteins | PHM30906 | Human Myeloid Leukemia Factor 1 (MLF1) | Recombinant Protein | 20 ug |
| Proteins | PM65011 | Human Myeloperoxidase (MPO) | Purified Protein | 50 ug |
| Proteins | PHM309011 | Human MYL2 | Recombinant Protein | 20 ug |
| Proteins | PHM31312 | Human MYL4 | Recombinant Protein | 20 ug |
| Proteins | PHM30875 | Human Myoglobin (MB) | Recombinant Protein | 20 ug |
| Proteins | PHM30621 | Human Myotrophin | Recombinant Protein | 20 ug |
| Proteins | PHM32263 | Human Myozenin-1 | Recombinant Protein | 20 ug |
| Proteins | PHM32514 | Human Myxovirus Resistance Protein 2 (MX2) | Recombinant Protein | 20 ug |
| Proteins | PHM32632 | Human MZB1 | Recombinant Protein | 20 ug |
| Proteins | PHN31474 | Human N acetylglucosamine kinase | Recombinant Protein | 20 ug |
| Proteins | PHN30386 | Human N-myc Downstream Regulated 1 protein (NDRG1) | Recombinant Protein | 20 ug |
| Proteins | PHN31286 | Human NACA1 | Recombinant Protein | 20 ug |
| Proteins | PHN31142 | Human NANOG | Recombinant Protein | 20 ug |
| Proteins | PHN30741 | Human NANP | Recombinant Protein | 20 ug |
| Proteins | PHN31298 | Human NAP1L1 | Recombinant Protein | 20 ug |
| Proteins | PHN31228 | Human NAPG | Recombinant Protein | 20 ug |
| Proteins | PHN31406 | Human NAT13 | Recombinant Protein | 20 ug |
| Proteins | PHN33001 | Human Natural Killer-Associated Transcript 1 (NKAT-1) | Recombinant Protein | 20 ug |
| Proteins | PHN31607 | Human NCE2 | Recombinant Protein | 20 ug |
| Proteins | PHN1769 | Human NCF4 | Recombinant Protein | 20 ug |
| Proteins | PHN0587 | Human NCK | Recombinant Protein | 20 ug |
| Proteins | PHN30526 | Human NCS1 | Recombinant Protein | 20 ug |
| Proteins | PHN32807 | Human NCS1 | Recombinant Protein | 20 ug |
| Proteins | PHN31692 | Human NDRG2 | Recombinant Protein | 20 ug |
| Proteins | PHN32556 | Human NDUFS5 | Recombinant Protein | 20 ug |
| Proteins | PHN32313 | Human NDUFV2 | Recombinant Protein | 20 ug |
| Proteins | PHN32345 | Human NDUFV3 | Recombinant Protein | 20 ug |
| Proteins | PHN32468 | Human NEDD4 Family-Interacting Protein 1 (NDFIP1) | Recombinant Protein | 20 ug |
| Proteins | PHN30905 | Human NEDD8 | Recombinant Protein | 20 ug |
| Proteins | PHN30362 | Human Neurokinin B | Recombinant Protein | 20 ug |
| Proteins | PHN32162 | Human Neuromedin-B (NMB) | Recombinant Protein | 10 ug |
| Proteins | PHN31846 | Human Neurotensin | Recombinant Protein | 20 ug |
| Proteins | PHN32002 | Human Neutral Cholesterol Ester Hydrolase 1 (NCEH1) | Recombinant Protein | 20 ug |
| Proteins | PHK1818 | Human NKG2D | Recombinant Protein | 20 ug |
| Proteins | PHN33250 | Human NM23A | Recombinant Protein | 10 ug |
| Proteins | PHN30361 | Human NME1 | Recombinant Protein | 20 ug |
| Proteins | PHN30490 | Human NME2 | Recombinant Protein | 20 ug |
| Proteins | PHN33251 | Human NME2 | Recombinant Protein | 10 ug |
| Proteins | PHN30889 | Human NME3 | Recombinant Protein | 20 ug |
| Proteins | PHN33260 | Human NME3 | Recombinant Protein | 10 ug |
| Proteins | PHN0643 | Human NMNAT1 | Recombinant Protein | 20 ug |
| Proteins | PHN31586 | Human NMRAL1 | Recombinant Protein | 20 ug |
| Proteins | PHN32932 | Human NMT1 | Recombinant Protein | 20 ug |
| Proteins | PHN30910 | Human NMT2 | Recombinant Protein | 20 ug |
| Proteins | PHN30320 | Human NNMT | Recombinant Protein | 20 ug |
| Proteins | PHN32069 | Human Nociceptin (PNOC) | Recombinant Protein | 20 ug |
| Proteins | PHN32290 | Human Norrin (NDP) | Recombinant Protein | 10 ug |
| Proteins | PHN31179 | Human Novel Neurotrophin-1 (NNT-1) | Recombinant Protein | 20 ug |
| Proteins | PHN31028 | Human NPL | Recombinant Protein | 20 ug |
| Proteins | PHN30392 | Human NQO1 | Recombinant Protein | 20 ug |
| Proteins | PHN30522 | Human NQO2 | Recombinant Protein | 20 ug |
| Proteins | PHN32214 | Human NSL1 | Recombinant Protein | 20 ug |
| Proteins | PHN32231 | Human NSMCE1 | Recombinant Protein | 20 ug |
| Proteins | PHN31229 | Human NT5C2 | Recombinant Protein | 20 ug |
| Proteins | PHN33046 | Human NuBP1 | Recombinant Protein | 20 ug |
| Proteins | PHN30747 | Human Nuclear Cap-Binding Protein Subunit 2 (NCBP2) | Recombinant Protein | 20 ug |
| Proteins | PHN30595 | Human Nuclear Transport Factor 2 (NTF-2) | Recombinant Protein | 20 ug |
| Proteins | PHN31046 | Human Nucleoside Diphosphate Kinase D (NDPKD, NME4) | Recombinant Protein | 20 ug |
| Proteins | PHN32578 | Human NUDCD2 | Recombinant Protein | 20 ug |
| Proteins | PHN1029 | Human NUDT10 | Recombinant Protein | 20 ug |
| Proteins | PHN31965 | Human NUDT14 | Recombinant Protein | 20 ug |
| Proteins | PHN31062 | Human NUDT9 | Recombinant Protein | 20 ug |
| Proteins | PHN32608 | Human NUP62CL | Recombinant Protein | 20 ug |
| Proteins | PHN31440 | Human NXT2 | Recombinant Protein | 20 ug |
| Proteins | PHM30901 | Human O-6-Methylguanine-DNA Methyltransferase (MGMT) | Recombinant Protein | 20 ug |
| Proteins | PHO32353 | Human OBFC2A | Recombinant Protein | 20 ug |
| Proteins | PHO32152 | Human Oligoribonuclease | Recombinant Protein | 20 ug |
| Proteins | PHO1125 | Human Omentin | Recombinant Protein | 20 ug |
| Proteins | PHO31123 | Human Oncostatin-M | Recombinant Protein | 20 ug |
| Proteins | PHO32914 | Human Opticin (OPTC) | Recombinant Protein | 20 ug |
| Proteins | PHO32218 | Human Orosomucoid 2 | Recombinant Protein | 20 ug |
| Proteins | PHO30905 | Human OSTF1 | Recombinant Protein | 20 ug |
| Proteins | PHO31038 | Human OTUB2 | Recombinant Protein | 20 ug |
| Proteins | PHO30354 | Human Otubain-1 (OTUB1) | Recombinant Protein | 20 ug |
| Proteins | PHO32848 | Human Oxidative Stress-Responsive 1 Protein (OXSR1) | Recombinant Protein | 20 ug |
| Proteins | PHP32648 | Human P15RS | Recombinant Protein | 20 ug |
| Proteins | PHP31075 | Human p16 ARC | Recombinant Protein | 20 ug |
| Proteins | PHP30921 | Human p21-Activated Kinase 4 (PAK-4) | Recombinant Protein | 20 ug |
| Proteins | PHP32035 | Human p21-ARC | Recombinant Protein | 20 ug |
| Proteins | PHP30418 | Human p23 | Recombinant Protein | 20 ug |
| Proteins | PHP31264 | Human P27 KIP1 | Recombinant Protein | 20 ug |
| Proteins | PHP32500 | Human PABPN1 | Recombinant Protein | 20 ug |
| Proteins | PHP31674 | Human PAFAH1B3 | Recombinant Protein | 20 ug |
| Proteins | PHP33043 | Human PAFAH2 | Recombinant Protein | 20 ug |
| Proteins | PHP32628 | Human PAICS | Recombinant Protein | 20 ug |
| Proteins | PHP30416 | Human PAIP2 | Recombinant Protein | 20 ug |
| Proteins | PHP33021 | Human Parathyroid Hormone (PTH) | Recombinant Protein | 20 ug |
| Proteins | PHP30601 | Human PARK7/DJ1 | Recombinant Protein | 20 ug |
| Proteins | PHP30469 | Human PARP1 | Recombinant Protein | 20 ug |
| Proteins | PHP32003 | Human PARP2 | Recombinant Protein | 20 ug |
| Proteins | PHP30779 | Human Parvalbumin alpha (PVALB) | Recombinant Protein | 20 ug |
| Proteins | PHP30699 | Human PCBD1 | Recombinant Protein | 20 ug |
| Proteins | PHP30578 | Human PCMT1 | Recombinant Protein | 20 ug |
| Proteins | PHP308012 | Human PCNA | Recombinant Protein | 20 ug |
| Proteins | PHP2996 | Human PCPE-1 | Recombinant Protein | 20 ug |
| Proteins | PHP30658 | Human PDAP1 | Recombinant Protein | 20 ug |
| Proteins | PHP30802 | Human PDCD5 | Recombinant Protein | 20 ug |
| Proteins | PHP31383 | Human PDCL3 | Recombinant Protein | 20 ug |
| Proteins | PHP32527 | Human PDLIM1 | Recombinant Protein | 20 ug |
| Proteins | PHP30382 | Human PEBP1 | Recombinant Protein | 20 ug |
| Proteins | PHP30605 | Human PECI | Recombinant Protein | 20 ug |
| Proteins | PHP31239 | Human PECR | Recombinant Protein | 20 ug |
| Proteins | PHP30312 | Human Pentraxin 3 | Recombinant Protein | 20 ug |
| Proteins | PHP31913 | Human Peptide-O-fucosyltransferase 1 (POFUT1) | Recombinant Protein | 20 ug |
| Proteins | PHP33011 | Human Peptidyl-prolyl cis/trans Isomerase (Pin1) | Recombinant Protein | 20 ug |
| Proteins | PHA32694 | Human Perilipin 2 (PLIN2, ADFP) | Recombinant Protein | 20 ug |
| Proteins | PHP30801 | Human Peroxiredoxin-1 (PRDX1) | Recombinant Protein | 20 ug |
| Proteins | PHP30268 | Human Peroxiredoxin-2 (PRDX2) | Recombinant Protein | 20 ug |
| Proteins | PHP30321 | Human Peroxiredoxin-3 (PRDX3) | Recombinant Protein | 20 ug |
| Proteins | PHP30513 | Human Peroxiredoxin-4 (PRDX4) | Recombinant Protein | 20 ug |
| Proteins | PHP30339 | Human Peroxiredoxin-5 (PRDX5) | Recombinant Protein | 20 ug |
| Proteins | PHP30356 | Human Peroxiredoxin-6 (PRDX6) | Recombinant Protein | 20 ug |
| Proteins | PHP31201 | Human PEX19 | Recombinant Protein | 20 ug |
| Proteins | PHP31161 | Human PFDN5 | Recombinant Protein | 20 ug |
| Proteins | PHP31427 | Human PGAM2 | Recombinant Protein | 20 ug |
| Proteins | PHP30504 | Human PGD | Recombinant Protein | 20 ug |
| Proteins | PHP33238 | Human PGD | Recombinant Protein | 10 ug |
| Proteins | PHP30355 | Human PGK1 | Recombinant Protein | 20 ug |
| Proteins | PHP33249 | Human PGK1 | Recombinant Protein | 10 ug |
| Proteins | PHP31349 | Human PGK2 | Recombinant Protein | 10 ug |
| Proteins | PHP33135 | Human PGM2 | Recombinant Protein | 20 ug |
| Proteins | PHP31839 | Human PGPEP1 | Recombinant Protein | 20 ug |
| Proteins | PHP31974 | Human Phosphoethanolamine/phosphocholine Phosphatase (PHOSPHO1) | Recombinant Protein | 20 ug |
| Proteins | PHP33158 | Human Phosphoglucomutase-1 (PGM 1 ) | Recombinant Protein | 20 ug |
| Proteins | PHP31972 | Human Phosphoglycolate Phosphatase (PGP) | Recombinant Protein | 20 ug |
| Proteins | PHP30751 | Human Phosphohistidine Phosphatase 1 (PHPT1) | Recombinant Protein | 20 ug |
| Proteins | PHP30521 | Human Phosphoserine Phosphatase (PSP) | Recombinant Protein | 20 ug |
| Proteins | PHP30572 | Human PIG3 | Recombinant Protein | 20 ug |
| Proteins | PHP31240 | Human PINK1 | Recombinant Protein | 20 ug |
| Proteins | PHP0310 | Human PINX1 | Recombinant Protein | 20 ug |
| Proteins | PHP32308 | Human PIP | Recombinant Protein | 20 ug |
| Proteins | PHP31413 | Human Pirin | Recombinant Protein | 20 ug |
| Proteins | PHP30826 | Human PITPN | Recombinant Protein | 20 ug |
| Proteins | PHP30778 | Human PITPNB | Recombinant Protein | 20 ug |
| Proteins | PHP30988 | Human PKIB | Recombinant Protein | 20 ug |
| Proteins | PHP30429 | Human PKM2 | Recombinant Protein | 20 ug |
| Proteins | PHP2661 | Human PLA1A | Recombinant Protein | 20 ug |
| Proteins | PHP32362 | Human Placenta-specific Gene 8 Protein (PLAC8) | Recombinant Protein | 20 ug |
| Proteins | PP40011 | Human Plasmin | Purified Protein | 100 ug |
| Proteins | PP12001 | Human Plasminogen (PLG) | Purified Protein | 0.5 mg |
| Proteins | PHP30701 | Human Plasminogen Activator Inhibitor-1 (PAI-1) | Recombinant Protein | 20 ug |
| Proteins | PP12231 | Human Platelet Factor 4 (PF-4) | Purified Protein | 25 ug |
| Proteins | PHP31711 | Human Platelet-Derived Growth Factor D (PDGF-D) | Recombinant Protein | 20 ug |
| Proteins | PHP32568 | Human PLEKHF2 | Recombinant Protein | 20 ug |
| Proteins | PHP31908 | Human Plunc | Recombinant Protein | 20 ug |
| Proteins | PHP30727 | Human PMM2 | Recombinant Protein | 20 ug |
| Proteins | PHP30803 | Human PMP2 | Recombinant Protein | 20 ug |
| Proteins | PHP30733 | Human PMVK | Recombinant Protein | 20 ug |
| Proteins | PHP30417 | Human PNMT | Recombinant Protein | 20 ug |
| Proteins | PHP32185 | Human PNRC2 | Recombinant Protein | 20 ug |
| Proteins | PHP31843 | Human POLR2E | Recombinant Protein | 20 ug |
| Proteins | PHP32647 | Human POLR2F | Recombinant Protein | 20 ug |
| Proteins | PHP32771 | Human PPA2 | Recombinant Protein | 20 ug |
| Proteins | PHP30637 | Human PPAR gamma | Recombinant Protein | 20 ug |
| Proteins | PHP30748 | Human PPCDC | Recombinant Protein | 20 ug |
| Proteins | PHP31064 | Human PPCS | Recombinant Protein | 20 ug |
| Proteins | PHP309011 | Human PPIL1 | Recombinant Protein | 20 ug |
| Proteins | PHP31230 | Human PPIL3 | Recombinant Protein | 20 ug |
| Proteins | PHP0801 | Human PPM1G | Recombinant Protein | 20 ug |
| Proteins | PHP31150 | Human PPME1 | Recombinant Protein | 20 ug |
| Proteins | PHP32330 | Human PPP1R3B | Recombinant Protein | 20 ug |
| Proteins | PHP33160 | Human PPP2R1A | Recombinant Protein | 20 ug |
| Proteins | PHP32288 | Human PPP4C | Recombinant Protein | 20 ug |
| Proteins | PHP31540 | Human PQBP1 | Recombinant Protein | 20 ug |
| Proteins | PP65325 | Human Prealbumin (Transthyretin, TTR) | Purified Protein | 0.5 mg |
| Proteins | PHP30456 | Human Prealbumin (Transthyretin, TTR) | Recombinant Protein | 20 ug |
| Proteins | PHP32250 | Human Pregnancy-specific Glycoprotein 5 (PSBG-5) | Recombinant Protein | 20 ug |
| Proteins | PK21111 | Human Prekallikrein (PK) | Purified Protein | 100 ug |
| Proteins | PHP2666 | Human PRKACB | Recombinant Protein | 20 ug |
| Proteins | PHP30862 | Human PRL-1 | Recombinant Protein | 20 ug |
| Proteins | PHP30398 | Human PRL-3 | Recombinant Protein | 20 ug |
| Proteins | PHP0802 | Human PRMT1 | Recombinant Protein | 20 ug |
| Proteins | PHP30376 | Human Profilin-1 | Recombinant Protein | 20 ug |
| Proteins | PHP30509 | Human Profilin-4 | Recombinant Protein | 20 ug |
| Proteins | PHP31987 | Human Prohibitin (PHB) | Recombinant Protein | 10 ug |
| Proteins | PHP32184 | Human Prohibitin-2 (PHB2) | Recombinant Protein | 20 ug |
| Proteins | PHP30501 | Human Prolactin (PRL) | Recombinant Protein | 20 ug |
| Proteins | PHP31557 | Human Prostaglandin D Synthase (hematopoietic) | Recombinant Protein | 20 ug |
| Proteins | PHP31059 | Human Prostaglandin E Synthase 2 (mPGES-2, PTGES2) | Recombinant Protein | 20 ug |
| Proteins | PHP32956 | Human Prostatic Acid Phosphatase (ACPP) | Recombinant Protein | 20 ug |
| Proteins | PHP31287 | Human Proteasome 20S alpha 3 | Recombinant Protein | 20 ug |
| Proteins | PHP31241 | Human Proteasome 20S C2 | Recombinant Protein | 20 ug |
| Proteins | PP51021 | Human Protein C | Purified Protein | 50 ug |
| Proteins | PP51025 | Human Protein C | Purified Protein | 100 ug |
| Proteins | PHP33001 | Human Protein Phosphatase 1A (Formerly 2C), Magnesium-Dependent Alpha Isoform (PP2C-alpha) | Recombinant Protein | 20 ug |
| Proteins | PHP32281 | Human Protein Phosphatase 1F (PPM1F) | Recombinant Protein | 20 ug |
| Proteins | PP85412 | Human Protein S | Purified Protein | 100 ug |
| Proteins | PP32012 | Human Protein Z | Purified Protein | 50 ug |
| Proteins | PHP32001 | Human Protein-Tyrosine Phosphatase 1B (PTP-1B) | Recombinant Protein | 20 ug |
| Proteins | PHP33005 | Human Protein-Tyrosine Phosphatase MEG1 (MEG) | Recombinant Protein | 20 ug |
| Proteins | PHS32001 | Human Protein-Tyrosine Phosphatase, Non-Receptor Type 6 Isoform 1 (SHP-1) | Recombinant Protein | 20 ug |
| Proteins | PP65102 | Human Prothrombin (Factor II) | Purified Protein | 0.5 mg |
| Proteins | PHP33110 | Human PRPS2 | Recombinant Protein | 20 ug |
| Proteins | PHP32461 | Human PRPSAP2 | Recombinant Protein | 20 ug |
| Proteins | PHP31094 | Human PRTFDC1 | Recombinant Protein | 20 ug |
| Proteins | PHP1328 | Human PSAT1 | Recombinant Protein | 20 ug |
| Proteins | PHP31231 | Human PSMA2 | Recombinant Protein | 20 ug |
| Proteins | PHP31350 | Human PSMA4 | Recombinant Protein | 20 ug |
| Proteins | PHP309012 | Human PSMA7 | Recombinant Protein | 20 ug |
| Proteins | PHP31804 | Human PSMD9 | Recombinant Protein | 20 ug |
| Proteins | PHP31307 | Human PSMG4 | Recombinant Protein | 20 ug |
| Proteins | PHP30991 | Human Psoriasin | Recombinant Protein | 20 ug |
| Proteins | PHP32158 | Human PSTPIP1 | Recombinant Protein | 20 ug |
| Proteins | PHP31353 | Human PTEN-Like Phosphatase (PTPMT1) | Recombinant Protein | 20 ug |
| Proteins | PHP1635 | Human PTGR1 | Recombinant Protein | 20 ug |
| Proteins | PHP30830 | Human PTRH2 | Recombinant Protein | 20 ug |
| Proteins | PHS30452 | Human PTS | Recombinant Protein | 20 ug |
| Proteins | PHP32686 | Human PUR B | Recombinant Protein | 20 ug |
| Proteins | PHP30786 | Human Purine Nucleoside Phosphorylase (PNP) | Recombinant Protein | 20 ug |
| Proteins | PHP3066 | Human PYCR2 | Recombinant Protein | 20 ug |
| Proteins | PHP31397 | Human Pyrophosphatase 1 (PPA1) | Recombinant Protein | 20 ug |
| Proteins | PHP30904 | Human Pyruvate Dehydrogenase Kinase Isoform 1 (PDK1) | Recombinant Protein | 20 ug |
| Proteins | PHQ31172 | Human QDPR | Recombinant Protein | 20 ug |
| Proteins | PHQ30706 | Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) | Recombinant Protein | 20 ug |
| Proteins | PHR30557 | Human RAB11A | Recombinant Protein | 20 ug |
| Proteins | PHR31108 | Human RAB17 | Recombinant Protein | 20 ug |
| Proteins | PHR31290 | Human RAB23 | Recombinant Protein | 20 ug |
| Proteins | PHR31247 | Human RAB24 | Recombinant Protein | 20 ug |
| Proteins | PHR30556 | Human RAB27A | Recombinant Protein | 20 ug |
| Proteins | PHR31359 | Human RAB2B | Recombinant Protein | 20 ug |
| Proteins | PHR31246 | Human RAB32 | Recombinant Protein | 20 ug |
| Proteins | PHR31102 | Human RAB3D | Recombinant Protein | 20 ug |
| Proteins | PHR31104 | Human RAB4 | Recombinant Protein | 20 ug |
| Proteins | PHR30701 | Human RAB5a | Recombinant Protein | 20 ug |
| Proteins | PHR30403 | Human RAC1 | Recombinant Protein | 20 ug |
| Proteins | PHR305011 | Human RAC1 | Recombinant Protein | 20 ug |
| Proteins | PHR30365 | Human RAC2 | Recombinant Protein | 20 ug |
| Proteins | PHR32508 | Human RAD51D | Recombinant Protein | 20 ug |
| Proteins | PHR30555 | Human RAD6 | Recombinant Protein | 20 ug |
| Proteins | PHR30822 | Human RALA | Recombinant Protein | 20 ug |
| Proteins | PHR31466 | Human RANBP1 | Recombinant Protein | 20 ug |
| Proteins | PHR32714 | Human RANBP3 | Recombinant Protein | 20 ug |
| Proteins | PHR31966 | Human RAP2B | Recombinant Protein | 20 ug |
| Proteins | PHR32157 | Human RARRES1 | Recombinant Protein | 20 ug |
| Proteins | PHR31311 | Human RBBP9 | Recombinant Protein | 20 ug |
| Proteins | PHR31309 | Human RCAN2 | Recombinant Protein | 20 ug |
| Proteins | PHR30698 | Human RCL | Recombinant Protein | 20 ug |
| Proteins | PHR30501 | Human Recoverin | Recombinant Protein | 20 ug |
| Proteins | PHR31187 | Human Regucalcin (RGN) | Recombinanat Protein | 20 ug |
| Proteins | PHR31732 | Human Renalase | Recombinant Protein | 20 ug |
| Proteins | PHR32177 | Human Renin | Recombinant Protein | 20 ug |
| Proteins | PHR32510 | Human Resistin | Recombinant Protein | 10 ug |
| Proteins | PHR31434 | Human Reticulocalbin 3 (RCN3) | Recombinant Protein | 20 ug |
| Proteins | PHR32522 | Human Retinaldehyde-Binding Protein 1 (RLBP1) | Recombinant Protein | 20 ug |
| Proteins | PHR31656 | Human Retinoblastoma-Binding Protein 4 (RBBP-4) | Recombinant Protein | 20 ug |
| Proteins | PHR30801 | Human Retinoic Acid Receptor alpha | Recombinant Protein | 20 ug |
| Proteins | PHR30936 | Human Retinoid-Binding Protein 7 (RBP7) | Recombinant Protein | 20 ug |
| Proteins | PR80011 | Human Retinol Binding Protein (RBP4) | Purified Protein | 50 ug |
| Proteins | PR10051 | Human Retinol-Binding Protein (RBP) | Purified Protein | 200 ug |
| Proteins | PHR32048 | Human Retinol-Binding Protein 2 (RBP2) | Recombinant Protein | 20 ug |
| Proteins | PHR0701 | Human Retinol-Binding Protein 4 (RBP4) | Recombinant Protein | 20 ug |
| Proteins | PHR13103 | Human Retinol-Binding Protein 4 (RBP4) | Purified Protein | 25 ug |
| Proteins | PHR30721 | Human Retinol-Binding Protein 4 (RBP4) | Recombinant Protein | 20 ug |
| Proteins | PHR32668 | Human REV1 | Recombinant Protein | 20 ug |
| Proteins | PHR31144 | Human RGS10 | Recombinant Protein | 20 ug |
| Proteins | PHR31200 | Human RGS17 | Recombinant Protein | 20 ug |
| Proteins | PHR31157 | Human RGS21 | Recombinant Protein | 20 ug |
| Proteins | PHR31170 | Human RGS5 | Recombinant Protein | 20 ug |
| Proteins | PHR0901 | Human Rheb | Recombinant Protein | 20 ug |
| Proteins | PHR30775 | Human RhoGDI | Recombinant Protein | 20 ug |
| Proteins | PHR30358 | Human Riboflavin Kinase (RFK) | Recombinant Protein | 20 ug |
| Proteins | PHR31809 | Human Ribonuclease 3 (RNASE3) | Recombinant Protein | 20 ug |
| Proteins | PHR31439 | Human Ribulose-Phosphate 3-Epimerase (RPE) | Recombinant Protein | 20 ug |
| Proteins | PHR32071 | Human RNA Polymerases I, II, III Subunit ABC3 (RPB17) | Recombinant Protein | 20 ug |
| Proteins | PHN32331 | Human RNA-Binding Protein NOB1 (NOB1) | Recombinant Protein | 20 ug |
| Proteins | PHR31148 | Human RND1 | Recombinant Protein | 20 ug |
| Proteins | PHR30651 | Human RND3 | Recombinant Protein | 20 ug |
| Proteins | PHR31761 | Human RNF4 | Recombinant Protein | 20 ug |
| Proteins | PHR31897 | Human RPC39 | Recombinant Protein | 20 ug |
| Proteins | PHR31755 | Human RPC8 | Recombinant Protein | 20 ug |
| Proteins | PHR32189 | Human RPL26 | Recombinant Protein | 20 ug |
| Proteins | PHR32336 | Human RPL34 | Recombinant Protein | 20 ug |
| Proteins | PHR32335 | Human RPL35A | Recombinant Protein | 20 ug |
| Proteins | PHR31405 | Human RPLP2 | Recombinant Protein | 20 ug |
| Proteins | PHR30821 | Human RPP30 | Recombinant Protein | 20 ug |
| Proteins | PHR33048 | Human RPRD1B | Recombinant Protein | 20 ug |
| Proteins | PHR32458 | Human RPS4X | Recombinant Protein | 20 ug |
| Proteins | PHR30787 | Human RQCD1 | Recombinant Protein | 20 ug |
| Proteins | PHR30396 | Human RRAS2 | Recombinant Protein | 20 ug |
| Proteins | PHR32662 | Human RSU1 | Recombinant Protein | 20 ug |
| Proteins | PHR31360 | Human RTN4IP1 | Recombinant Protein | 20 ug |
| Proteins | PHR32907 | Human RTP4 | Recombinant Protein | 20 ug |
| Proteins | PHS30628 | Human S100 beta | Recombinant Protein | 20 ug |
| Proteins | PHS30958 | Human S100A10 | Recombinant Protein | 20 ug |
| Proteins | PHS30968 | Human S100A11 | Recombinant Protein | 20 ug |
| Proteins | PHS30969 | Human S100A14 | Recombinant Protein | 20 ug |
| Proteins | PHS31018 | Human S100A16 | Recombinant Protein | 20 ug |
| Proteins | PHS1078 | Human S100A3 | Recombinant Protein | 20 ug |
| Proteins | PHS30319 | Human S100A4 | Recombinant Protein | 20 ug |
| Proteins | PHS0967 | Human S100A6 | Recombinant Protein | 20 ug |
| Proteins | PHS30543 | Human S100A9 | Recombinant Protein | 20 ug |
| Proteins | PHS33314 | Human S100B | Recombinant Protein | 20 ug |
| Proteins | PHS30588 | Human S100Z | Recombinant Protein | 20 ug |
| Proteins | PHS31909 | Human SAMD13 | Recombinant Protein | 20 ug |
| Proteins | PHS31910 | Human SAR1B | Recombinant Protein | 20 ug |
| Proteins | PHS0364 | Human SAT1 | Recombinant Protein | 20 ug |
| Proteins | PHS31445 | Human SAT2 | Recombinant Protein | 20 ug |
| Proteins | PHS32928 | Human SCO1 | Recombinant Protein | 20 ug |
| Proteins | PHS32706 | Human SDF2 | Recombinant Protein | 20 ug |
| Proteins | PHS31008 | Human SEC13L1 | Recombinant Protein | 20 ug |
| Proteins | PHS31709 | Human SEC22L1 | Recombinant Protein | 20 ug |
| Proteins | PHS33096 | Human Secernin-1 (SCRN1) | Recombinant Protein | 20 ug |
| Proteins | PHS32606 | Human Secreted Frizzled-Related Protein 2 (SFRP2) | Recombinant Protein | 20 ug |
| Proteins | PHS32213 | Human Secretogranin-3 (SCG3) | Recombinant Protein | 20 ug |
| Proteins | PHI24112 | Human Secretory Immunoglobulin A (IgA) | Purified Protein | 100 ug |
| Proteins | PHS32151 | Human Semenogelin-1 | Recombinant Protein | 20 ug |
| Proteins | PHS31112 | Human SENP8 | Recombinant Protein | 20 ug |
| Proteins | PHS31043 | Human Sentan (SNTN) | Recombinant Protein | 20 ug |
| Proteins | PHS32106 | Human SEP15 | Recombinant Protein | 20 ug |
| Proteins | PHS31121 | Human SEPT5 | Recombinant Protein | 20 ug |
| Proteins | PHS31244 | Human SEPT6 | Recombinant Protein | 20 ug |
| Proteins | PHS30717 | Human Septin 2 | Recombinant Protein | 10 ug |
| Proteins | PHS32919 | Human Septin 3 | Recombinant Protein | 20 ug |
| Proteins | PHS32813 | Human SEPW1 | Recombinant Protein | 20 ug |
| Proteins | PHS31242 | Human Serglycin | Recombinant Protein | 20 ug |
| Proteins | PHS3092 | Human Serpin B3 | Recombinant Protein | 20 ug |
| Proteins | PHS32909 | Human Serpin B8 | Recombinant Protein | 20 ug |
| Proteins | PHS32765 | Human Serpin D1 | Recombinant Protein | 20 ug |
| Proteins | PHA30793 | Human Serum Amyloid A-4 (SAA4) | Recombinant Protein | 20 ug |
| Proteins | PHS7902Y | Human Serum Amyloid A (SAA) | Recombinant Protein | 50 ug |
| Proteins | PHS80142 | Human Serum Amyloid A (SAA) | Recombinant Protein | 20 ug |
| Proteins | PHS32191 | Human SET | Recombinant Protein | 20 ug |
| Proteins | PHS33001 | Human SET Domain-containing Protein 7 (SET7/9) | Recombinant Protein | 20 ug |
| Proteins | PHS31888 | Human SFRP3 | Recombinant Protein | 20 ug |
| Proteins | PHS32966 | Human SFRP5 | Recombinant Protein | 20 ug |
| Proteins | PHS30533 | Human SGTA | Recombinant Protein | 20 ug |
| Proteins | PHS30783 | Human SH2D1A | Recombinant Protein | 20 ug |
| Proteins | PHS31640 | Human SH3BGRL | Recombinant Protein | 20 ug |
| Proteins | PHS31715 | Human SH3BGRL3 | Recombinant Protein | 20 ug |
| Proteins | PHS32933 | Human SH3GL3 | Recombinant Protein | 20 ug |
| Proteins | PHS31128 | Human SHC | Recombinant Protein | 20 ug |
| Proteins | PHS31310 | Human SHMT1 | Recombinant Protein | 20 ug |
| Proteins | PHS30762 | Human Shwachman Bodian-Diamond Syndrome | Recombinant Protein | 20 ug |
| Proteins | PHS30784 | Human Sialic Acid Synthase (SAS) | Recombinant Protein | 20 ug |
| Proteins | PHS32625 | Human Sirtuin 1 (SIRT1) | Recombinant Protein | 20 ug |
| Proteins | PHS1758 | Human SIX6 | Recombinant Protein | 20 ug |
| Proteins | PHS30430 | Human SKP1 | Recombinant Protein | 20 ug |
| Proteins | PHS309011 | Human SMAD4 | Recombinant Protein | 20 ug |
| Proteins | PHS31848 | Human SMUG1 | Recombinant Protein | 20 ug |
| Proteins | PHS0601 | Human SNAP25 | Recombinant Protein | 20 ug |
| Proteins | PHS308012 | Human SNAP25 | Recombinant Protein | 20 ug |
| Proteins | PHS30901 | Human Snapin | Recombinant Protein | 20 ug |
| Proteins | PHS31071 | Human SNIP1 | Recombinant Protein | 20 ug |
| Proteins | PHS30640 | Human SNURPORTIN1 | Recombinant Protein | 20 ug |
| Proteins | PHS31101 | Human SNX3 | Recombinant Protein | 20 ug |
| Proteins | PHS308011 | Human SOD1 | Recombinant Protein | 20 ug |
| Proteins | PHS30512 | Human SOD2 | Recombinant Protein | 20 ug |
| Proteins | PHS33037 | Human Sonic Hedgehog | Recombinant Protein | 10 ug |
| Proteins | PHS30574 | Human Sorbitol Dehydrogenase | Recombinant Protein | 20 ug |
| Proteins | PHS30514 | Human SOX2 | Recombinant Protein | 20 ug |
| Proteins | PHS3902 | Human SPARC | Recombinant Protein | 10 ug |
| Proteins | PHS30794 | Human Spermidine Synthase (SPDSY) | Recombinant Protein | 20 ug |
| Proteins | PHS31782 | Human SPFH2 | Recombinant Protein | 20 ug |
| Proteins | PHS30287 | Human SPG21 | Recombinant Protein | 20 ug |
| Proteins | PHS0288 | Human SPR | Recombinant Protein | 20 ug |
| Proteins | PHS32326 | Human SPRY4 | Recombinant Protein | 20 ug |
| Proteins | PHS30532 | Human SQSTM1 | Recombinant Protein | 20 ug |
| Proteins | PHS32028 | Human SSBP1 | Recombinant Protein | 20 ug |
| Proteins | PHS31821 | Human SSR4 | Recombinant Protein | 20 ug |
| Proteins | PHS31401 | Human SSU72 | Recombinant Protein | 20 ug |
| Proteins | PHS31985 | Human SSX1 | Recombinant Protein | 10 ug |
| Proteins | PHS32418 | Human ST3GAL5 | Recombinant Protein | 20 ug |
| Proteins | PHS33035 | Human ST6GAL1 | Recombinant Protein | 20 ug |
| Proteins | PHS32142 | Human Stanniocalcin-2 (STC-2) | Recombinant Protein | 20 ug |
| Proteins | PHS31292 | Human STAR | Recombinant Protein | 20 ug |
| Proteins | PHS32435 | Human STARD5 | Recombinant Protein | 20 ug |
| Proteins | PHS30279 | Human Stathmin-1 | Recombinant Protein | 20 ug |
| Proteins | PHS32143 | Human Stathmin-4 (RB3, STMN4) | Recombinant Protein | 20 ug |
| Proteins | PHS30601 | Human Stem Cell Factor (SCF) | Recombinant Protein | 20 ug |
| Proteins | PHS3391 | Human STI1 | Recombinant Protein | 20 ug |
| Proteins | PHS32172 | Human Stomatin | Recombinant Protein | 20 ug |
| Proteins | PHS31553 | Human STX11 | Recombinant Protein | 20 ug |
| Proteins | PHS32110 | Human Sulfotransferase 1C4 (SULT1C4) | Recombinant Protein | 20 ug |
| Proteins | PHS1135 | Human SULT1A2 | Recombinant Protein | 20 ug |
| Proteins | PHS31537 | Human SULT1B1 | Recombinant Protein | 20 ug |
| Proteins | PHS1083 | Human SULT2A1 | Recombinant Protein | 20 ug |
| Proteins | PHS0301 | Human SUMO1 | Recombinant Protein | 20 ug |
| Proteins | PHS31293 | Human SUMO1 | Recombinant Protein | 20 ug |
| Proteins | PHS30289 | Human SUMO2 | Recombinant Protein | 20 ug |
| Proteins | PHS33022 | Human SUOX | Recombinant Protein | 20 ug |
| Proteins | PHS36825 | Human Superoxide Dismutase | Purified Protein | 20 ug |
| Proteins | PHS30451 | Human SURF1 | Recombinant Protein | 20 ug |
| Proteins | PHS30801 | Human Survivin (BIRC5) | Recombinant Protein | 20 ug |
| Proteins | PHV30710 | Human Synaptobrevin-2 | Recombinant Protein | 20 ug |
| Proteins | PHS30611 | Human Synaptosomal-associated Protein 25 (SNAP-25) | Recombinant Protein | 20 ug |
| Proteins | PHS32637 | Human Synaptotagmin-3 (SYT3) | Recombinant Protein | 20 ug |
| Proteins | PHS32390 | Human Synaptotagmin-5 | Recombinant Protein | 10 ug |
| Proteins | PHS31467 | Human Syndecan-1 | Recombinant Protein | 20 ug |
| Proteins | PHS2570 | Human SYNJ2BP | Recombinant Protein | 20 ug |
| Proteins | PHS30902 | Human Syntaphilin | Recombinant Protein | 20 ug |
| Proteins | PHS30706 | Human Syntaxin-1A | Recombinant Protein | 20 ug |
| Proteins | PHS31502 | Human Syntaxin-3 | Recombinant Protein | 20 ug |
| Proteins | PHS31667 | Human Syntaxin-4 | Recombinant Protein | 20 ug |
| Proteins | PHS32343 | Human Syntaxin-6 | Recombinant Protein | 20 ug |
| Proteins | PHS30809 | Human Syntenin-1 | Recombinant Protein | 20 ug |
| Proteins | PHC32289 | Human T-Cell Antigen CD7 (CD7) | Recombinant Protein | 20 ug |
| Proteins | PHT31875 | Human T-Cell Immunoglobulin Mucin Receptor 3 (TIM-3) | Recombinant Protein | 20 ug |
| Proteins | PHT31879 | Human TAC1 | Recombinant Protein | 20 ug |
| Proteins | PHT32400 | Human TACO1 | Recombinant Protein | 20 ug |
| Proteins | PHT30898 | Human TAF9 | Recombinant Protein | 20 ug |
| Proteins | PHT32934 | Human TATDN1 | Recombinant Protein | 20 ug |
| Proteins | PHT31294 | Human TAX1BP3 | Recombinant Protein | 20 ug |
| Proteins | PHT32298 | Human TBC1D13 | Recombinant Protein | 20 ug |
| Proteins | PHT31937 | Human TBCEL | Recombinant Protein | 20 ug |
| Proteins | PHT31070 | Human TCEAL1 | Recombinant Protein | 20 ug |
| Proteins | PHT31363 | Human TCEB1 | Recombinant Protein | 20 ug |
| Proteins | PHT30901 | Human TCEB2 | Recombinant Protein | 20 ug |
| Proteins | PHT30391 | Human TCL1A | Recombinant Protein | 20 ug |
| Proteins | PHT32403 | Human TCL1B | Recombinant Protein | 20 ug |
| Proteins | PHT31705 | Human TDG | Recombinant Protein | 20 ug |
| Proteins | PHT32635 | Human Testis-Specific Kinase 6 (TSSK-6) | Recombinant Protein | 20 ug |
| Proteins | PHT32588 | Human TGF-beta Receptor-associated Protein 1 (TRAP-1) | Recombinant Protein | 10 ug |
| Proteins | PHT30383 | Human TGF-beta-1 | Recombinant Protein | 10 ug |
| Proteins | PHT33026 | Human TGF-beta-3 | Recombinant Protein | 20 ug |
| Proteins | PHT30601 | Human TGFBI | Recombinant Protein | 20 ug |
| Proteins | THT3355 | Human TGFBR2 | Recombinant Protein | 10 ug |
| Proteins | PHT32603 | Human TGIF2LX | Recombinant Protein | 20 ug |
| Proteins | PHT32555 | Human TGIF2LY | Recombinant Protein | 20 ug |
| Proteins | PHT30530 | Human Thioredoxin | Recombinant Protein | 20 ug |
| Proteins | PHT30511 | Human Thioredoxin-1 (TRX1) | Recombinant Protein | 20 ug |
| Proteins | PHT30801 | Human Thioredoxin-2 (TRX2) | Recombinant Protein | 20 ug |
| Proteins | PHT31388 | Human Thrombin | Recombinant Protein | 20 ug |
| Proteins | PHT4037 | Human Thrombospondin 5 | Recombinant Protein | 10 ug |
| Proteins | PHT31610 | Human Thymidine Kinase 1 | Recombinant Protein | 20 ug |
| Proteins | PHT30446 | Human Thymidylate Synthase (TS) | Recombinant Protein | 20 ug |
| Proteins | PHT30760 | Human THYN1 | Recombinant Protein | 20 ug |
| Proteins | PT62051 | Human Thyroxine-Binding Globulin (TBG) | Purified Protein | 100 ug |
| Proteins | PHT31687 | Human TIMP-2 | Recombinant Protein | 20 ug |
| Proteins | PHT30631 | Human TIP30 | Recombinant Protein | 20 ug |
| Proteins | PHT30629 | Human TIP49A | Recombinant Protein | 20 ug |
| Proteins | PHT33013 | Human Tissue Inhibitor of Metalloproteinases 1 (TIMP-1) | Recombinant Protein | 10 ug |
| Proteins | PHT33097 | Human Tissue Inhibitor of Metalloproteinases 1 (TIMP-1) | Recombinant Protein | 10 ug |
| Proteins | PHT31049 | Human TL1A | Recombinant Protein | 20 ug |
| Proteins | PHT30501 | Human TNF-alpha | Recombinant Protein | 20 ug |
| Proteins | PHT33152 | Human TNF-alpha | Recombinant Protein | 10 ug |
| Proteins | PHT32150 | Human TNFAIP8 | Recombinant Protein | 10 ug |
| Proteins | PHT31260 | Human TNNC1 | Recombinant Protein | 10 ug |
| Proteins | PHT30332 | Human TNNC2 | Recombinant Protein | 20 ug |
| Proteins | PHT32149 | Human TOMM34 | Recombinant Protein | 20 ug |
| Proteins | PHT32050 | Human Tomoregulin-1 (TMEFF1) | Recombinant Protein | 20 ug |
| Proteins | PHT31415 | Human TPK1 | Recombinant Protein | 20 ug |
| Proteins | PHT30701 | Human TPMT | Recombinant Protein | 20 ug |
| Proteins | PHT32229 | Human TPPP3 | Recombinant Protein | 20 ug |
| Proteins | PHT33033 | Human TPST1 | Recombinant Protein | 20 ug |
| Proteins | PHT30571 | Human TRAF1 | Recombinant Protein | 20 ug |
| Proteins | PHT308011 | Human TRAIL | Recombinant Protein | 20 ug |
| Proteins | PHM31931 | Human Transcription Factor MafK (MAFK) | Recombinant Protein | 20 ug |
| Proteins | PHT32984 | Human Transferrin Receptor (TFRC) | Recombinant Protein | 20 ug |
| Proteins | PHT31234 | Human Transgelin-3 (TAGLN3) | Recombinant Protein | 20 ug |
| Proteins | PHT34000 | Human Transglutaminase 2 (TGM2) | Recombinant Protein | 50 ug |
| Proteins | PHT34001 | Human Transglutaminase 2 (TGM2) | Recombinant Protein | 50 ug |
| Proteins | PHT34005 | Human Transglutaminase 6 (TGM6) | Recombinant Protein | 50 ug |
| Proteins | PHA30466 | Human Translationally Controlled Tumor Protein (TCTP) | Recombinant Protein | 20 ug |
| Proteins | PHT30761 | Human Translin | Recombinant Protein | 20 ug |
| Proteins | PHG32280 | Human Transmembrane Glycoprotein NMB (GPNMB) | Recombinant Protein | 20 ug |
| Proteins | PHT31751 | Human TRC40 | Recombinant Protein | 20 ug |
| Proteins | PHT30763 | Human Triosephosphate Isomerase (TIM) | Recombinant Protein | 20 ug |
| Proteins | PHT31917 | Human TROP2 | Recombinant Protein | 20 ug |
| Proteins | PHT31791 | Human Troponin I | Recombinant Protein | 20 ug |
| Proteins | PHT0329 | Human Troponin T (Cardiac) | Recombinant Protein | 20 ug |
| Proteins | PHT30329 | Human Troponin T (Cardiac) | Recombinant Protein | 20 ug |
| Proteins | PHT30627 | Human Tryptophanyl tRNA synthetase | Recombinant Protein | 20 ug |
| Proteins | PHT31370 | Human TSSC4 | Recombinant Protein | 20 ug |
| Proteins | PHT30423 | Human TST | Recombinant Protein | 20 ug |
| Proteins | PHT30562 | Human TTC11 | Recombinant Protein | 20 ug |
| Proteins | PHT32882 | Human TTDA | Recombinant Protein | 20 ug |
| Proteins | PHT31680 | Human TULP1 | Recombinant Protein | 20 ug |
| Proteins | PHT31450 | Human TXNDC17 | Recombinant Protein | 20 ug |
| Proteins | PHT30892 | Human TXNL1 | Recombinant Protein | 20 ug |
| Proteins | PHT30570 | Human TXNRD1 | Recombinant Protein | 20 ug |
| Proteins | PHT31950 | Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) | Recombinant Protein | 20 ug |
| Proteins | PHT32096 | Human Tyrosylprotein Sulfotransferase 2 (TPST-2) | Recombinant Protein | 10 ug |
| Proteins | PHT31851 | Human TYW5 | Recombinant Protein | 20 ug |
| Proteins | PHU3001 | Human UBC9 | Recombinant Protein | 20 ug |
| Proteins | PHU31681 | Human UBE2C | Recombinant Protein | 20 ug |
| Proteins | PHU31074 | Human UBE2D1 | Recombinant Protein | 20 ug |
| Proteins | PHU31147 | Human UBE2D2 | Recombinant Protein | 20 ug |
| Proteins | PHU33690 | Human UBE2D2 | Recombinant Protein | 20 ug |
| Proteins | PHU31243 | Human UBE2D4 | Recombinant Protein | 20 ug |
| Proteins | PHU31690 | Human UBE2E1 | Recombinant Protein | 20 ug |
| Proteins | PHU3132 | Human UBE2E3 | Recombinant Protein | 20 ug |
| Proteins | PHU32890 | Human UBE2G1 | Recombinant Protein | 20 ug |
| Proteins | PHU33119 | Human UBE2G2 | Recombinant Protein | 20 ug |
| Proteins | PHU31508 | Human UBE2H | Recombinant Protein | 20 ug |
| Proteins | PHU31608 | Human UBE2J2 | Recombinant Protein | 20 ug |
| Proteins | PHU3003 | Human UBE2L3 | Recombinant Protein | 20 ug |
| Proteins | PHU31603 | Human UBE2M | Recombinant Protein | 20 ug |
| Proteins | PHU30993 | Human UBE2N | Recombinant Protein | 20 ug |
| Proteins | PHU33163 | Human Ubiquilin-2 (UBQLN2) | Recombinant Protein | 20 ug |
| Proteins | PHU33002 | Human Ubiquitin | Recombinant Protein | 20 ug |
| Proteins | PHU33003 | Human Ubiquitin Conjugating Enzyme 7 (UBC7) | Recombinant Protein | 20 ug |
| Proteins | PHU31069 | Human Ubiquitin Thioesterase L5 (UCH-L5) | Recombinant Protein | 20 ug |
| Proteins | PHU31081 | Human UBL3 | Recombinant Protein | 20 ug |
| Proteins | PHU31418 | Human UBL4A | Recombinant Protein | 20 ug |
| Proteins | PHU31697 | Human UBTD2 | Recombinant Protein | 20 ug |
| Proteins | PHU30701 | Human UCH-L1 | Recombinant Protein | 20 ug |
| Proteins | PHU30872 | Human UCH-L3 | Recombinant Protein | 20 ug |
| Proteins | PHU33014 | Human UDP-Glucuronosyltransferase 1-1 (UGT1A1) | Recombinant Protein | 20 ug |
| Proteins | PHU31731 | Human ULBP1 | Recombinant Protein | 20 ug |
| Proteins | PHU31820 | Human ULBP4 | Recombinant Protein | 20 ug |
| Proteins | PHU31788 | Human UMPS | Recombinant Protein | 20 ug |
| Proteins | PHU32457 | Human UQCRH | Recombinant Protein | 20 ug |
| Proteins | PHU30804 | Human Uridine-Cytidine Kinase 2 (UCK 2) | Recombinant Protein | 20 ug |
| Proteins | PHU30994 | Human URM1 | Recombinant Protein | 20 ug |
| Proteins | PHU0612 | Human UROD | Recombinant Protein | 20 ug |
| Proteins | PHU31903 | Human Uroplakin-2 (UP2) | Recombinant Protein | 20 ug |
| Proteins | PHU31066 | Human UROS | Recombinant Protein | 20 ug |
| Proteins | PHU31921 | Human USP14 | Recombinant Protein | 20 ug |
| Proteins | PHU31847 | Human UXT | Recombinant Protein | 20 ug |
| Proteins | PHV31419 | Human Vacuolar Protein Sorting-Associated Protein (VTA1) Homolog | Recombinant Protein | 20 ug |
| Proteins | PHV30400 | Human Vacuolar Protein Sorting-Associated Protein 28 Homolog (VPS28) | Recombinant Protein | 20 ug |
| Proteins | PHV0711 | Human VAMP1 | Recombinant Protein | 20 ug |
| Proteins | PHV308011 | Human VAMP3 | Recombinant Protein | 20 ug |
| Proteins | PHV30298 | Human VAMP5 | Recombinant Protein | 20 ug |
| Proteins | PHV30901 | Human VAMP8 | Recombinant Protein | 20 ug |
| Proteins | PHV30701 | Human Vaspin (Serpin A12) | Recombinant Protein | 20 ug |
| Proteins | PHV31861 | Human VBP-1 | Recombinant Protein | 20 ug |
| Proteins | PHV30282 | Human VEGF 121 | Recombinant Protein | 20 ug |
| Proteins | PHV31248 | Human VEGF 165 | Recombinant Protein | 20 ug |
| Proteins | PHV33001 | Human VHL | Recombinant Protein | 20 ug |
| Proteins | PHV30801 | Human Visfatin | Recombinant Protein | 20 ug |
| Proteins | PHV30384 | Human Visinin-like Protein 1 (VSNL1) | Recombinant Protein | 20 ug |
| Proteins | PHV3849 | Human Vitronectin (VTN) | Recombinant Protein | 50 ug |
| Proteins | PHV36800 | Human Vitronectin (VTN) | Purified Protein | 25 ug |
| Proteins | PV10212 | Human Von Willebrand Factor (VWF) | Purified Protein | 50 ug |
| Proteins | PHV31076 | Human VOPP1 | Recombinant Protein | 10 ug |
| Proteins | PHV31103 | Human VPS24 | Recombinant Protein | 20 ug |
| Proteins | PHW30632 | Human WDR5 | Recombinant Protein | 20 ug |
| Proteins | PHW31177 | Human WDR68 | Recombinant Protein | 20 ug |
| Proteins | PHX2509 | Human XRCC2 | Recombinant Protein | 20 ug |
| Proteins | PHX32271 | Human XTP4 | Recombinant Protein | 20 ug |
| Proteins | PHY32159 | Human YAE1D1 | Recombinant Protein | 20 ug |
| Proteins | PHZ32708 | Human Zinc Finger Protein 32 (ZNF32) | Recombinant Protein | 20 ug |
| Proteins | PHZ32627 | Human ZNHIT1 | Recombinant Protein | 20 ug |
| Proteins | PHZ32327 | Human ZNHIT3 | Recombinant Protein | 20 ug |
| Proteins | PHZ32401 | Human ZNRD1 | Recombinant Protein | 20 ug |
| Proteins | PKH36815 | Monkey Haptoglobin Antibody | Purified Protein | 50 ug |
| Proteins | PKT32285 | Monkey Transferrin | Purified Protein | 100 ug |
| Proteins | PMA33001 | Mouse Adiponectin (gACRP30) | Recombinant Protein | 20 ug |
| Proteins | PMA3525 | Mouse AGR2 | Recombinant Protein | 20 ug |
| Proteins | PMA32982 | Mouse AKR1B1 | Recombinant Protein | 20 ug |
| Proteins | PMA3103 | Mouse ALDH2 | Recombinant Protein | 20 ug |
| Proteins | PMA33075 | Mouse Aldolase C | Recombinant Protein | 20 ug |
| Proteins | PMA30801 | Mouse alpha B Crystallin | Recombinant Protein | 20 ug |
| Proteins | PMA33193 | Mouse alpha-2-Antiplasmin | Recombinant Protein | 10 ug |
| Proteins | PMS0619 | Mouse alpha-Synuclein | Recombinant Protein | 20 ug |
| Proteins | PMA32995 | Mouse Annexin A1 (ANXA1) | Recombinant Protein | 20 ug |
| Proteins | PMA3060 | Mouse Annexin A5 (ANXA5) | Recombinant Protein | 20 ug |
| Proteins | PA60105 | Mouse Antithrombin III (AT3) | Purified Protein | 25 ug |
| Proteins | PMA33058 | Mouse Apolipoprotein A-I (Apo-A1) | Recombinant Protein | 20 ug |
| Proteins | PMA3908 | Mouse Asparagine Synthetase (ASNS) | Recombinant Protein | 10 ug |
| Proteins | PMA33085 | Mouse Aspartate Aminotransferase (cAspAT) | Recombinant Protein | 20 ug |
| Proteins | PMB33191 | Mouse Bcl-XL | Recombinant Protein | 20 ug |
| Proteins | PMC33231 | Mouse C1qR1 | Recombinant Protein | 10 ug |
| Proteins | PHB3890 | Mouse CD276 | Recombinant Protein | 10 ug |
| Proteins | PMC3512 | Mouse CREG1 Antibody | Recombinant Protein | 20 ug |
| Proteins | PMC33670 | Mouse CRYGD | Recombinant Protein | 20 ug |
| Proteins | PMC32981 | Mouse Cyclophilin A | Recombinant Protein | 20 ug |
| Proteins | PMA33218 | Mouse Cystatin-C (Cst3) | Recombinant Protein | 20 ug |
| Proteins | PMD33750 | Mouse DDT | Recombinant Protein | 20 ug |
| Proteins | PMD33751 | Mouse Diazepam Binding Inhibitor | Recombinant Protein | 20 ug |
| Proteins | PMF33112 | Mouse Fetuin-A (AHSG) | Recombinant Protein | 10 ug |
| Proteins | PF10511 | Mouse Fibrinogen (FBG) | Purified Protein | 0.5 mg |
| Proteins | PMF31189 | Mouse Fibroblast Growth Factor 1 (FGF-1) | Recombinant Protein | 20 ug |
| Proteins | PMF33084 | Mouse FKBP12 | Recombinant Protein | 20 ug |
| Proteins | PMG31907 | Mouse Galectin-2 | Recombinant Protein | 20 ug |
| Proteins | PMG33247 | Mouse Galectin-2 (Gal-2) | Recombinant Protein | 10 ug |
| Proteins | PMG1784 | Mouse Galectin-4 (Gal-4) | Recombinant Protein | 10 ug |
| Proteins | PMG31759 | Mouse Galectin-7 (Gal-7) | Recombinant Protein | 20 ug |
| Proteins | PMG31772 | Mouse Galectin-8 (Gal-8) | Recombinant Protein | 10 ug |
| Proteins | PMG31887 | Mouse Galectin-9 (Gal-9) | Recombinant Protein | 10 ug |
| Proteins | PMG32988 | Mouse GAPDH | Recombinant Protein | 20 ug |
| Proteins | PMG32913 | Mouse GDF-15 | Recombinant Protein | 20 ug |
| Proteins | PMG32894 | Mouse GDF-5 | Recombinant Protein | 20 ug |
| Proteins | PMG3698 | Mouse Glutaredoxin-1 | Recombinant Protein | 20 ug |
| Proteins | PMG33086 | Mouse Glutathione S-Transferase A1 (GSTA1) | Recombinant Protein | 20 ug |
| Proteins | PMG30413 | Mouse Glutathione S-Transferase Mu 1 | Recombinant Protein | 20 ug |
| Proteins | PMG0801 | Mouse GM-CSF | Recombinant Protein | 10 ug |
| Proteins | PMG31621 | Mouse GRO gamma | Recombinant Protein | 20 ug |
| Proteins | PMG30905 | Mouse GSTM1 | Recombinant Protein | 20 ug |
| Proteins | PMG33146 | Mouse GSTP1 | Recombinant Protein | 20 ug |
| Proteins | PMG33315 | Mouse GSTP2 | Recombinant Protein | 20 ug |
| Proteins | PMH3517 | Mouse HPGD | Recombinant Protein | 20 ug |
| Proteins | PMI31516 | Mouse IL1RA | Recombinant Protein | 20 ug |
| Proteins | PMI32860 | Mouse IL33 | Recombinant Protein | 10 ug |
| Proteins | PMI32951 | Mouse IL34 | Recombinant Protein | 10 ug |
| Proteins | PMI30317 | Mouse Interferon beta (IFN-beta) | Recombinant Protein | 20 ug |
| Proteins | PMI33513 | Mouse Interferon gamma | Recombinant Protein | 20 ug |
| Proteins | PMI2863 | Mouse Interleukin-1 alpha Precursor (IL-1 alpha Precursor) | Recombinant Protein | 20 ug |
| Proteins | PMI30801 | Mouse Interleukin-1 beta (IL-1 beta) | Recombinant Protein | 20 ug |
| Proteins | PMI30292 | Mouse Interleukin-15 (IL-15) | Recombinant Protein | 10 ug |
| Proteins | PMI30271 | Mouse Interleukin-18 (IL-18) | Recombinant Protein | 20 ug |
| Proteins | PMI30905 | Mouse Interleukin-2 (IL-2) | Recombinant Protein | 20 ug |
| Proteins | PMI32987 | Mouse Interleukin-2 (IL-2) | Recombinant Protein | 10 ug |
| Proteins | PMI33166 | Mouse Interleukin-36 alpha (IL-36 alpha) | Recombinant Protein | 20 ug |
| Proteins | PMI2828 | Mouse Interleukin-6 (IL-6) | Recombinant Protein | 20 ug |
| Proteins | PMI33154 | Mouse Interleukin-6 (IL-6) | Recombinant Protein | 10 ug |
| Proteins | PML33109 | Mouse Latexin (LXN) | Recombinant Protein | 20 ug |
| Proteins | PML33668 | Mouse LC3B | Recombinant Protein | 20 ug |
| Proteins | PML0701 | Mouse Leptin | Recombinant Protein | 20 ug |
| Proteins | PML33093 | Mouse Lipocalin-2 | Recombinant Protein | 20 ug |
| Proteins | PML33133 | Mouse LRPAP1 | Recombinant Protein | 20 ug |
| Proteins | PML30720 | Mouse Lysophospholipase 1 (LPL-I) | Recombinant Protein | 20 ug |
| Proteins | PMM3906 | Mouse MER | Recombinant Protein | 10 ug |
| Proteins | PMM33091 | Mouse MIF | Recombinant Protein | 20 ug |
| Proteins | PMM31085 | Mouse MRP8 | Recombinant Protein | 20 ug |
| Proteins | PMM32060 | Mouse MUP1 | Recombinant Protein | 20 ug |
| Proteins | PMM33077 | Mouse MYL9 | Recombinant Protein | 20 ug |
| Proteins | PMN30801 | Mouse Nucleobindin-2 (NUCB2) | Recombinant Protein | 20 ug |
| Proteins | PMO4052 | Mouse Osteopontin (OPN) | Recombinant Protein | 10 ug |
| Proteins | PMP33151 | Mouse PARK7/DJ1 | Recombinant Protein | 20 ug |
| Proteins | PMP31645 | Mouse PD-L1 | Recombinant Protein | 20 ug |
| Proteins | PMP33172 | Mouse PEBP1 | Recombinant Protein | 20 ug |
| Proteins | PMP31496 | Mouse PGAM1 | Recombinant Protein | 20 ug |
| Proteins | PMP3072 | Mouse PGK1 | Recombinant Protein | 20 ug |
| Proteins | PMP30801 | Mouse PRMT1 | Recombinant Protein | 20 ug |
| Proteins | PMR3699 | Mouse RALA | Recombinant Protein | 20 ug |
| Proteins | PMR32405 | Mouse RAPSN | Recombinant Protein | 20 ug |
| Proteins | PMS3473 | Mouse S100 beta | Recombinant Protein | 20 ug |
| Proteins | PMS1089 | Mouse S100A1 | Recombinant Protein | 20 ug |
| Proteins | PMS31652 | Mouse S100A3 | Recombinant Protein | 20 ug |
| Proteins | PMS1080 | Mouse S100A4 | Recombinant Protein | 20 ug |
| Proteins | PMS31510 | Mouse S100A5 | Recombinant Protein | 20 ug |
| Proteins | PMS1092 | Mouse S100A6 | Recombinant Protein | 20 ug |
| Proteins | PHA3650 | Mouse SAHH | Recombinant Protein | 20 ug |
| Proteins | PMS33076 | Mouse SOD2 | Recombinant Protein | 20 ug |
| Proteins | PMS30537 | Mouse Sonic Hedgehog | Recombinant Protein | 20 ug |
| Proteins | PMS3891 | Mouse SPARC-like 1/SPARCL1 | Recombinant Protein | 10 ug |
| Proteins | PMS3652 | Mouse SPR | Recombinant Protein | 20 ug |
| Proteins | PMS30801 | Mouse Stem Cell Factor (SCF) | Recombinant Protein | 20 ug |
| Proteins | PMS3526 | Mouse STI1 | Recombinant Protein | 20 ug |
| Proteins | PMT32918 | Mouse TGF-beta-1 | Recombinant Protein | 10 ug |
| Proteins | PT62082 | Mouse Thrombin | Purified Protein | 50 ug |
| Proteins | PMT33186 | Mouse TIMP-1 | Recombinant Protein | 10 ug |
| Proteins | PMT33327 | Mouse Tissue Factor (TF) | Recombinant Protein | 10 ug |
| Proteins | PMT31475 | Mouse TNF-alpha | Recombinant Protein | 20 ug |
| Proteins | PMT33184 | Mouse TNF-alpha | Recombinant Protein | 10 ug |
| Proteins | PMT33090 | Mouse TPT1 | Recombinant Protein | 20 ug |
| Proteins | PMT11677 | Mouse Transferrin | Purified Protein | 100 ug |
| Proteins | PMT34008 | Mouse Transglutaminase 2 (TGM2) | Recombinant Protein | 50 ug |
| Proteins | PMU33089 | Mouse UCH-L1 | Recombinant Protein | 20 ug |
| Proteins | PMV33246 | Mouse VCAM1 | Recombinant Protein | 10 ug |
| Proteins | PMV30702 | Mouse Visfatin | Recombinant Protein | 20 ug |
| Proteins | PF10711 | Rabbit Fibrinogen (FBG) | Purified Protein | 0.5 mg |
| Proteins | PRI33227 | Rat IL-1RA | Recombinant Protein | 20 ug |
| Proteins | PHA33161 | Rat Alanine Transaminase (GPT1) | Recombinant Protein | 20 ug |
| Proteins | PA60151 | Rat Apotransferrin | Purified Protein | 1 mg |
| Proteins | PRC3203 | Rat C-Reactive Protein (CRP) | Recombinant Protein | 10 ug |
| Proteins | PRC33129 | Rat Cyclophilin F (PPIF) | Recombinant Protein | 20 ug |
| Proteins | PRE4000 | Rat Eosinophil Peroxidase (EPO) | Recombinant Protein | 10 ug |
| Proteins | PRF33126 | Rat Fatty Acid-Binding Protein 1 (FABP1) | Recombinant Protein | 20 ug |
| Proteins | PF10611 | Rat Fibrinogen (FBG) | Purified Protein | 1 mg |
| Proteins | PRI33192 | Rat Interleukin-1 alpha (IL-1 alpha) | Recombinant Protein | 20 ug |
| Proteins | PRI33167 | Rat Interleukin-33 (IL-33) | Recombinant Protein | 20 ug |
| Proteins | PRP33150 | Rat Nucleoside Diphosphate Kinase B (NDK B, NME2) | Recombinant Protein | 20 ug |
| Proteins | PRP33147 | Rat Peroxiredoxin-2 (PRDX2) | Recombinant Protein | 20 ug |
| Proteins | PRP33173 | Rat Profilin-1 (Pfn1) | Recombinant Protein | 20 ug |
| Proteins | PRT33178 | Rat TIMP-1 | Recombinant Protein | 10 ug |
| Proteins | PRT33128 | Rat TNF-alpha | Recombinant Protein | 20 ug |
| Proteins | PRT2105 | Rat Transferrin | Purified Protein | 100 ug |
| Proteins | PRT34002 | Rat Transglutaminase 2 (TGM2) | Recombinant Protein | 50 ug |
| Proteins | PSH30502 | S. cerevisiae Heat Shock Protein 104 (HSP104; Amino Acids 1-908) | Recombinant Protein | 20 ug |
| Proteins | PSG30801 | Schistosoma japonicum Glutathione S-Transferase(GST) | Recombinant Protein | 20 ug |
| Proteins | PF10911 | Swine Fibrinogen (FBG) | Purified Protein | 1 mg |
| Proteins | PST34003 | Swine Transglutaminase 2 (TGM2) | Recombinant Protein | 50 ug |
| AssayMax ELISA Kit | EA1101-1 | Aldosterone AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA1701-1 | Allopregnanolone AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EBH2003-1 | Bovine Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EBH2003-2 | Bovine Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EBS7780-1 | Bovine La Ribonucleoprotein (SSB) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EBP1200-1 | Bovine Plasminogen AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EBP2211-1 | Bovine Plasminogen AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ECF2040-1 | Canine Fibrinogen (FBG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ECH2003-1 | Canine Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ECR3005-1 | Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3001-1 | Corticosterone AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3021-1 | Cortisol AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ED3010-1 | Dihydrotestosterone (DHT) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERG3771-1 | Glucagon-Like Peptide 2 (GLP-2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH4820-1 | Histidyl-tRNA Synthetase (HARS) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH7301-1 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2550-1 | Human ADAMTS13 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7550-1 | Human ADAMTS13 Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7551-1 | Human ADAMTS13 Autoantibody IgM AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2879-1 | Human Adenine Phosphoribosyltransferase (APRT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2501-1 | Human Adenylate Kinase 4 (AK 4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2500-1 | Human Adiponectin (ACRP30) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2500-8 | Human Adiponectin (ACRP30) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5403-1 | Human AKR1B10 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3922-1 | Human Alanine Aminotransferase (ALT, GPT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2201-1 | Human Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3201-1 | Human Albumin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2201-7 | Human Albumin AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3201-7 | Human Albumin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2670-1 | Human Aldose Reductase (AR) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA2622-1 | Human ALKBH3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5001-1 | Human alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5101-1 | Human alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5001-8 | Human alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5101-8 | Human alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG2713-1 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5501-1 | Human alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5501-7 | Human alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5001-1 | Human alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5101-1 | Human alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5101-2 | Human alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5001-8 | Human alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5101-8 | Human alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7508-1 | Human alpha-1-Antitrypsin (A1AT) Autoantibody AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM5110-1 | Human alpha-1-Microglobulin (A1M) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM5110-7 | Human alpha-1-Microglobulin (A1M) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3477-1 | Human alpha-2-Antiplasmin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM1115-1 | Human alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2115-1 | Human alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM1115-7 | Human alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2115-7 | Human alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF6011-1 | Human alpha-Fetoprotein (AFP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF6011-7 | Human alpha-Fetoprotein (AFP) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA6501-1 | Human Amylase AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA6501-7 | Human Amylase AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5801-1 | Human Amyloid Precursor Protein (APP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5801-7 | Human Amyloid Precursor Protein (APP) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3612-1 | Human Annexin A1 (ANXA1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3612-7 | Human Annexin A1 (ANXA1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3651-1 | Human Annexin A10 (ANXA10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3613-1 | Human Annexin A13 (ANXA13) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3603-1 | Human Annexin A3 (ANXA3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3603-7 | Human Annexin A3 (ANXA3) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3602-1 | Human Annexin A4 (ANXA4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3601-1 | Human Annexin A5 (ANXA5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3601-7 | Human Annexin A5 (ANXA5) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3607-1 | Human Annexin A7 (ANXA7) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3301-1 | Human Antithrombin III (AT3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3303-1 | Human Antithrombin III (AT3) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3303-8 | Human Antithrombin III (AT3) AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA3301-8 | Human Antithrombin III (AT3) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5201-1 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5301-1 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5201-7 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5301-7 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5222-1 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5333-1 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit (High Sensitivity) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5333-7 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit (High Sensitivity) (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5222-7 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA5520-1 | Human Apolipoprotein A-V (Apo A5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7001-1 | Human Apolipoprotein B (Apo B) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7001-7 | Human Apolipoprotein B (Apo B) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8011-1 | Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8011-2 | Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8011-27 | Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8012-1 | Human Apolipoprotein C-II (Apo C2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8012-8 | Human Apolipoprotein C-II (Apo C2) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8133-1 | Human Apolipoprotein C-III (Apo C3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8133-7 | Human Apolipoprotein C-III (Apo C3) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8003-1 | Human Apolipoprotein E (Apo E) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8003-7 | Human Apolipoprotein E (Apo E) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8821-1 | Human Apolipoprotein H (Apo H, B2GP1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8821-8 | Human Apolipoprotein H (Apo H, B2GP1) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8710-1 | Human ARL2BP AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7711-1 | Human Arylsulfatase A (ASA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA4728-1 | Human AZGP1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8121-1 | Human Azurocidin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8121-7 | Human Azurocidin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EB3505-1 | Human B3GAT3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7501-1 | Human beta-2 GP1 Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7503-1 | Human beta-2 GP1 Autoantibody IgA AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7502-1 | Human beta-2 GP1 Autoantibody IgM AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM5001-1 | Human beta-2-Microglobulin (B2M) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM5001-7 | Human beta-2-Microglobulin (B2M) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1001-1 | Human C-Reactive Protein (CRP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1001-7 | Human C-Reactive Protein (CRP) AssayMax ELISA Kit (WHO Standard Calibrated Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1001-8 | Human C-Reactive Protein (CRP) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC7501-1 | Human C-Reactive Protein (CRP) Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3103-1 | Human Calprotectin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3103-7 | Human Calprotectin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3520-1 | Human Calreticulin-3 (CALR3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5752-1 | Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5359-1 | Human Carbonic Anhydrase 14 (CA14) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5105-1 | Human Carbonic Anhydrase 2 (CA2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5273-1 | Human Carbonic Anhydrase 3 (CA3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3135-1 | Human Carboxypeptidase E (CPE) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC4208-1 | Human Catalase AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2252-1 | Human Cathepsin E (CTSE) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3575-1 | Human Cathepsin F (CTSF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3237-1 | Human Cathepsin G AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3237-7 | Human Cathepsin G AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3105-1 | Human CCS AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3501-1 | Human CD300A (CLM-8) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3532-1 | Human Centromere Protein B (CENP-B) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC7530-1 | Human Centromere Protein B (CENP-B) Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2752-1 | Human Centromere Protein P (CENP-P) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC4201-1 | Human Ceruloplasmin (CP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC4201-7 | Human Ceruloplasmin (CP) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2374-1 | Human Chorionic Gonadotropin (hCG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2505-1 | Human CNDP2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3748-1 | Human Colipase (CLPS) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1111-1 | Human Complement C1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1111-7 | Human Complement C1 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1101-1 | Human Complement C1q AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1101-8 | Human Complement C1q AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC7701-1 | Human Complement C1q Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1102-1 | Human Complement C1r AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC1102-7 | Human Complement C1r AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2001-1 | Human Complement C2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2001-8 | Human Complement C2 AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2101-1 | Human Complement C3 AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3201-1 | Human Complement C3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2101-8 | Human Complement C3 AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3201-7 | Human Complement C3 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3301-1 | Human Complement C3b AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3301-8 | Human Complement C3b AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3331-1 | Human Complement C3d AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3331-7 | Human Complement C3d AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2102-1 | Human Complement C4 AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3202-1 | Human Complement C4 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2102-8 | Human Complement C4 AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3202-7 | Human Complement C4 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2202-1 | Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2202-7 | Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5101-1 | Human Complement C5 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC5101-8 | Human Complement C5 AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC6101-1 | Human Complement C6 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC6101-7 | Human Complement C6 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC7101-1 | Human Complement C7 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC7101-7 | Human Complement C7 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC8101-1 | Human Complement C8 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC8101-8 | Human Complement C8 AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC9101-1 | Human Complement C9 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC9101-8 | Human Complement C9 AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7700-1 | Human Complement Factor B AssayMax Autoantibody ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7001-1 | Human Complement Factor B AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7001-8 | Human Complement Factor B AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7701-1 | Human Complement Factor D AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7701-7 | Human Complement Factor D AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7055-1 | Human Complement Factor H AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF7055-8 | Human Complement Factor H AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF8005-1 | Human Complement Factor I AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF8005-7 | Human Complement Factor I AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF8011-1 | Human Complement Factor P AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF8011-7 | Human Complement Factor P AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3505-1 | Human Complexin-1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2720-1 | Human CRYZ AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2270-1 | Human CXCL7 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP6500-1 | Human Cyclophilin F (PPIF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2050-1 | Human Cyclophilin-40 (PPID) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2785-1 | Human Cystathionine gamma-lyase (CTH) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2583-1 | Human Cystatin-A (CSTA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2301-1 | Human Cystatin-B (CSTB) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2301-7 | Human Cystatin-B (CSTB) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2502-1 | Human Cystatin-C (CST3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2502-7 | Human Cystatin-C (CST3) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2421-1 | Human Cystatin-D (CST5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2421-7 | Human Cystatin-D (CST5) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2455-1 | Human Cystatin-E/M (CST6) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2442-1 | Human Cystatin-S (CST4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2442-7 | Human Cystatin-S (CST4) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC2255-1 | Human Cystatin-SN (CST1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ED2527-1 | Human DDT AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ED1030-1 | Human Dipeptidyl Peptidase IV (DPP4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE2310-1 | Human ECHS1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE1001-1 | Human Elastase (Neutrophil ELA2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE1001-7 | Human Elastase (Neutrophil ELA2) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE2231-1 | Human Eosinophil Peroxidase (EPO) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE2231-7 | Human Eosinophil Peroxidase (EPO) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE2011-1 | Human Epidermal Growth Factor (EGF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE3520-1 | Human ESM1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EE2702-1 | Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1009-1 | Human Factor IX (Factor 9) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1009-8 | Human Factor IX (Factor 9) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1009-7 | Human Factor IX (Factor 9) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1005-1 | Human Factor V (Factor 5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1005-8 | Human Factor V (Factor 5) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1007-1 | Human Factor VII (Factor 7) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2007-1 | Human Factor VII (Factor 7) AssayMax ELISA Kit (High Sensitivity) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2007-8 | Human Factor VII (Factor 7) AssayMax ELISA Kit (High Sensitivity; WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2007-7 | Human Factor VII (Factor 7) AssayMax ELISA Kit (High Sensitivity; WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1007-8 | Human Factor VII (Factor 7) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1007-7 | Human Factor VII (Factor 7) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1008-1 | Human Factor VIII (Factor 8) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1008-7 | Human Factor VIII (Factor 8) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1010-1 | Human Factor X (Factor 10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1010-2 | Human Factor X (Factor 10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1010-27 | Human Factor X (Factor 10) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1010-8 | Human Factor X (Factor 10) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1011-1 | Human Factor XI (Factor 11) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1011-8 | Human Factor XI (Factor 11) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1011-7 | Human Factor XI (Factor 11) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1012-1 | Human Factor XII (Factor 12) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1012-7 | Human Factor XII (Factor 12) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1013-1 | Human Factor XIII (Factor 13) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1013-8 | Human Factor XIII (Factor 13) AssayMax ELISA Kit (Positive & Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2702-1 | Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2702-7 | Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2705-1 | Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2705-7 | Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF3721-1 | Human FBP1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2003-1 | Human Ferritin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2003-8 | Human Ferritin AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3501-1 | Human Fetuin-A (Alpha-2-HS-Glycoprotein) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3501-7 | Human Fetuin-A (Alpha-2-HS-Glycoprotein) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1040-1 | Human Fibrinogen (FBG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1040-2 | Human Fibrinogen (FBG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2040-1 | Human Fibrinogen (FBG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2040-7 | Human Fibrinogen (FBG) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1040-27 | Human Fibrinogen (FBG) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF3021-1 | Human Fibroblast Growth Factor 21 (FGF-21) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF3021-7 | Human Fibroblast Growth Factor 21 (FGF-21) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1045-1 | Human Fibronectin (FN) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2045-1 | Human Fibronectin (FN) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF1045-8 | Human Fibronectin (FN) AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EF2045-7 | Human Fibronectin (FN) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3311-1 | Human Galectin-3 (Gal-3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3312-1 | Human Galectin-4 (Gal-4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5133-1 | Human GARS AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3845-1 | Human Gastric Inhibitory Polypeptide (GIP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3801-1 | Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3811-1 | Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3801-8 | Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG5701-1 | Human Geminin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3780-1 | Human Ghrelin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG7502-1 | Human Gliadin IgA AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG7501-1 | Human Gliadin IgG AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG1001-1 | Human Glucokinase (Hexokinase-4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG1001-7 | Human Glucokinase (Hexokinase-4) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG2153-1 | Human Glutaredoxin-1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3852-1 | Human Glutaredoxin-2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3928-1 | Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG2350-1 | Human Glutathione S-Transferase Zeta 1 (GSTZ1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG2827-1 | Human Glutathione Synthetase (GSS) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG7150-1 | Human GOT1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7652-1 | Human GOT2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA7652-7 | Human GOT2 AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG1060-1 | Human GPIIbIIIa AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG1060-7 | Human GPIIbIIIa AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG2710-1 | Human Growth Hormone (GH) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EG3711-1 | Human Guanase (GDA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH1003-1 | Human Haptoglobin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2003-1 | Human Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH1003-7 | Human Haptoglobin AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2233-1 | Human Haptoglobin-Related Protein (HPR) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2429-1 | Human HDHD2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH5215-1 | Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH5001-1 | Human Heat Shock Protein 27 (HSP27) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH7001-1 | Human Heat Shock Protein 27 (HSP27) Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH5202-1 | Human Heat Shock Protein 47 (HSP47) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH5505-1 | Human Heat Shock Protein 60 (HSP60) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH1001-1 | Human Hemopexin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2001-1 | Human Hemopexin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH1001-7 | Human Hemopexin AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2001-7 | Human Hemopexin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH3101-1 | Human Hexokinase-1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH3102-1 | Human Hexokinase-2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH1111-1 | Human High Density Lipoprotein (HDL) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH2647-1 | Human High Temperature Requirement Protein A2 (HTRA2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH5337-1 | Human HPRT1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EH7102-1 | Human HSD17B1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI3505-1 | Human ICAT AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7001-1 | Human Immunoglobulin A (IgA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7001-7 | Human Immunoglobulin A (IgA) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7800-1 | Human Immunoglobulin D (IgD) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7200-1 | Human Immunoglobulin G (IgG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7200-7 | Human Immunoglobulin G (IgG) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7201-1 | Human Immunoglobulin G3 (IgG3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7201-8 | Human Immunoglobulin G3 (IgG3) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1701-1 | Human Immunoglobulin J Chain (IGJ) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7301-1 | Human Immunoglobulin M (IgM) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI7301-7 | Human Immunoglobulin M (IgM) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1770-1 | Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1001-1 | Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1001-7 | Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI3030-1 | Human Interferon alpha-2b AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1023-1 | Human Interferon-gamma (IFN-gamma) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI2200-1 | Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI2200-7 | Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI2301-1 | Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI3010-1 | Human Interleukin-10 (IL-10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI3015-1 | Human Interleukin-15 (IL-15) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI3033-1 | Human Interleukin-33 (IL-33) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1006-1 | Human Interleukin-6 (IL-6) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EI1008-1 | Human Interleukin-8 (IL-8) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK1110-1 | Human Kallikrein-11 (KLK11) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK1001-1 | Human Kininogen (HMW) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK1001-7 | Human Kininogen (HMW) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK1021-1 | Human Kininogen (LMW) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK2802-1 | Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2255-1 | Human L-Lactate Dehydrogenase B Chain (LDHB) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL1011-1 | Human Lactoferrin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2011-1 | Human Lactoferrin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL1011-7 | Human Lactoferrin AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2011-7 | Human Lactoferrin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL7011-1 | Human Lactoferrin Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3103-1 | Human LAP TGF-beta1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2001-1 | Human Leptin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2001-7 | Human Leptin AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2301-1 | Human Leucine-rich alpha-2-Glycoprotein (LRG1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL2301-7 | Human Leucine-rich alpha-2-Glycoprotein (LRG1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3502-1 | Human Lipocalin-1 (LCN1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3510-1 | Human Lipocalin-2 (NGAL) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL7510-1 | Human Lipocalin-2 (NGAL) Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3001-1 | Human Lipoprotein (a) [Lp(a)] AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3001-7 | Human Lipoprotein (a) [Lp(a)] AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3205-1 | Human Livin (BIRC7) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3010-1 | Human Lysozyme AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3020-1 | Human Lysozyme AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3010-7 | Human Lysozyme AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EL3020-7 | Human Lysozyme AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2530-1 | Human Macrophage Colony Stimulating Factor (MCSF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2511-1 | Human Macrophage Migration Inhibitory Factor (MIF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2720-1 | Human Mannose-binding Lectin 2 (MBL2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM3725-1 | Human Matrix Metalloproteinase-2 (MMP-2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2715-1 | Human Matrix Metalloproteinase-9 (MMP-9) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2010-1 | Human Melanoregulin (MREG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2735-1 | Human Metalloreductase STEAP4 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2520-1 | Human MGMT AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2328-1 | Human MSRB2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM2215-1 | Human Myelin Basic Protein (MBP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM6501-1 | Human Myeloperoxidase (MPO) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM6501-7 | Human Myeloperoxidase (MPO) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EM7501-1 | Human Myeloperoxidase Autoantibody (p-ANCA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EN2550-1 | Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EN2010-1 | Human Nucleoside Diphosphate Kinase D (NDPKD) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3201-1 | Human p21-Activated Kinase 4 (PAK-4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1105-1 | Human PAI-1/tPA AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP5211-1 | Human Parathyroid Hormone (PTH) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2877-1 | Human Pentraxin 3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2775-1 | Human Perilipin 2 (PLIN2, ADFP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3577-1 | Human Peroxiredoxin-4 (PRDX4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2205-1 | Human Peroxiredoxin-5 (PRDX5) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2535-1 | Human Peroxiredoxin-6 (PRDX6) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2530-1 | Human Phosphoserine Phosphatase (PSP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1505-1 | Human PIP AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1807-1 | Human Plasmin-Alpha-2-Antiplasmin (PAP) Complex AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1200-1 | Human Plasminogen (PLG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1200-8 | Human Plasminogen (PLG) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1100-1 | Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1100-7 | Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3910-1 | Human PLUNC AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3010-1 | Human Prealbumin (Transthyretin, TTR) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3010-7 | Human Prealbumin (Transthyretin, TTR) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK2111-1 | Human Prekallikrein (PK) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EK2111-8 | Human Prekallikrein (PK) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1311-1 | Human Protein C AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2312-1 | Human Protein C AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1311-8 | Human Protein C AssayMax ELISA Kit (Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2312-7 | Human Protein C AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2527-1 | Human Protein Phosphatase 1F (PPM1F) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1331-1 | Human Protein S (Total) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP1331-8 | Human Protein S (Total) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP7758-1 | Human Protein S-C4BP Complexe AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3333-1 | Human Protein Z AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3333-7 | Human Protein Z AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2331-1 | Human Proteinase 3 (PR3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP2331-7 | Human Proteinase 3 (PR3) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP7331-1 | Human Proteinase 3 Autoantibody (cANCA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3023-1 | Human Prothrombin (Factor II) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP3023-7 | Human Prothrombin (Factor II) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EP4201-1 | Human PSMD9 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EQ2210-1 | Human QPRT AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER5010-1 | Human Recoverin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER1001-1 | Human Resistin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER1001-7 | Human Resistin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER1005-1 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER2005-1 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER1005-7 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER2005-7 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER3005-1 | Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER3005-7 | Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER5201-1 | Human Ro52 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ER7501-1 | Human Ro52 Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES2301-1 | Human S100A16 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES3711-1 | Human SAMD13 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES5108-1 | Human Sentan (SNTN) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8001-1 | Human Serum Amyloid A (SAA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8001-8 | Human Serum Amyloid A (SAA) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8201-1 | Human Serum Amyloid P Component (SAP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EA8201-8 | Human Serum Amyloid P Component (SAP) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES3880-1 | Human SH3GL3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES2475-1 | Human Sialic Acid Synthase (SAS) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES3821-1 | Human SNAP-alpha AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES3731-1 | Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES3211-1 | Human Stathmin-4 (RB3, STMN4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ES1001-1 | Human Stem Cell Factor (SCF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EC3502-1 | Human T-Cell Antigen CD7 (CD7) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3301-1 | Human TDP1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3102-1 | Human TGF-beta-1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET4010-1 | Human Thrombin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET7501-1 | Human Thrombin Autoantibody AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1020-1 | Human Thrombin-Antithrombin Complex (TAT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1020-7 | Human Thrombin-Antithrombin Complex (TAT) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1002-1 | Human Tissue Factor (TF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1002-7 | Human Tissue Factor (TF) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1005-1 | Human Tissue Factor Pathway Inhibitor (TFPI) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1005-7 | Human Tissue Factor Pathway Inhibitor (TFPI) AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1001-1 | Human Tissue-type Plasminogen Activator (tPA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET1001-8 | Human Tissue-type Plasminogen Activator (tPA) AssayMax ELISA Kit (Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2001-1 | Human Tissue-type Plasminogen Activator (tPA)(Total tPA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2001-7 | Human Tissue-type Plasminogen Activator (tPA)(Total tPA) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2010-1 | Human TNF-alpha AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2010-7 | Human TNF-alpha AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2105-1 | Human Transferrin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3105-1 | Human Transferrin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2105-7 | Human Transferrin AssayMax ELISA Kit (Positive Control Included) | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3105-7 | Human Transferrin AssayMax ELISA Kit (Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET5111-1 | Human Transglutaminase 6 (TGM6) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET5122-1 | Human Transglutaminase 7 (TGM7) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET2515-1 | Human Transmembrane Glycoprotein NMB (GPNMB) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ET3025-1 | Human Triosephosphate Isomerase (TIM) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EU1001-1 | Human Urokinase (uPA) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EV3005-1 | Human Vaspin (Serpin A12) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EV2030-1 | Human Von Willebrand Factor (VWF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EV2030-8 | Human Von Willebrand Factor (VWF) AssayMax ELISA Kit (WHO Standard Calibrated Positive and Low Controls Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EV2030-7 | Human Von Willebrand Factor (VWF) AssayMax ELISA Kit (WHO Standard Calibrated Positive Control Included) | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EV3010-1 | Human VTA1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EX1500-1 | Human XRCC2 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKA2201-1 | Monkey Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKA3201-1 | Monkey Albumin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKC3201-1 | Monkey Complement C3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKH2003-1 | Monkey Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKI7100-1 | Monkey Immunoglobulin G (IgG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EKI7201-1 | Monkey Immunoglobulin G (IgG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA2500-1 | Mouse Adiponectin (ACRP30) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA2201-1 | Mouse Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA3201-1 | Mouse Albumin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA3477-1 | Mouse alpha-2-Antiplasmin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMM1115-1 | Mouse alpha-2-Macroglobulin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA3301-1 | Mouse Antithrombin III (AT3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA5301-1 | Mouse Apolipoprotein A-I (Apo-A1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMC1001-1 | Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMC1101-1 | Mouse Complement C1q AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMC3201-1 | Mouse Complement C3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMF7701-1 | Mouse Complement Factor D AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMC2501-1 | Mouse Cystatin-C (CST3) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EME2011-1 | Mouse Epidermal Growth Factor (EGF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMF1040-1 | Mouse Fibrinogen (FBG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMF2040-1 | Mouse Fibrinogen (FBG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMF1045-1 | Mouse Fibronectin (FN) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMG2758-1 | Mouse Glutathione S-Transferase A1 (GSTA1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMG7150-1 | Mouse GOT1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMH2001-1 | Mouse Hemopexin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI3001-1 | Mouse Immunoglobulin M (IgM) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI1001-1 | Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI1023-1 | Mouse Interferon-gamma (IFN-gamma) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI2200-1 | Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI3010-1 | Mouse Interleukin-10 (IL-10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMI1006-1 | Mouse Interleukin-6 (IL-6) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EML2001-1 | Mouse Leptin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EML3510-1 | Mouse Lipocalin-2 (NGAL) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMM2304-1 | Mouse MUP1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMM8001-1 | Mouse Myoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMP1200-1 | Mouse Plasminogen (PLG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMP2211-1 | Mouse Plasminogen (PLG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMP3022-1 | Mouse Prothrombin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMR1001-1 | Mouse Resistin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMR3005-1 | Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMS2735-1 | Mouse S100A4 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMA8201-1 | Mouse Serum Amyloid P Component (SAP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMS1001-1 | Mouse Stem Cell Factor (SCF) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMT1020-1 | Mouse Thrombin-Antithrombin (TAT) Complex AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMT2010-1 | Mouse TNF-alpha AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMT2105-1 | Mouse Transferrin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EMV1801-1 | Mouse VCAM1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ETA2202-1 | Rabbit Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA2500-1 | Rat Adiponectin (ACRP30) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA3922-1 | Rat Alanine Aminotransferase (ALT, GPT) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA2201-1 | Rat Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA3201-1 | Rat Albumin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERM1115-1 | Rat alpha-2-Macroglobulin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA7010-1 | Rat Atrial Natriuretic Peptide (ANP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERB1201-1 | Rat Brain Natriuretic Peptide 32 (BNP-32) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERB1202-1 | Rat Brain Natriuretic Peptide 45 (BNP-45) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERC1001-1 | Rat C-Reactive Protein (CRP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERC4101-1 | Rat Ceruloplasmin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERC1101-1 | Rat Complement C1q AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERC3201-1 | Rat Complement C3 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERC3331-1 | Rat Complement C3b AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERF7055-1 | Rat Complement Factor H AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERF1040-1 | Rat Fibrinogen (FBG) AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERF2040-1 | Rat Fibrinogen (FBG) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERF1045-1 | Rat Fibronectin (FN) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERH1003-1 | Rat Haptoglobin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERH2003-1 | Rat Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERH2001-1 | Rat Hemopexin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERI3010-1 | Rat Interleukin-10 (IL-10) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERP1200-1 | Rat Plasminogen AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERA8201-1 | Rat Serum Amyloid P Component (SAP) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERT2538-1 | Rat TIMP-1 AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERT2010-1 | Rat TNF-alpha AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERT2105-1 | Rat Transferrin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERT3105-1 | Rat Transferrin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | ERT5030-1 | Rat Transglutaminase 2 (TGM2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EPA2201-1 | Swine Albumin AssayMax ELISA Kit | Competitive ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EPA3201-1 | Swine Albumin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EPH2003-1 | Swine Haptoglobin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EPP3022-1 | Swine Prothrombin AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| AssayMax ELISA Kit | EST5030-1 | Swine Transglutaminase 2 (TGM2) AssayMax ELISA Kit | Sandwich ELISA | 96 Well Plate |
| Chromogenic | CF1007 | Human Factor VII (Factor 7) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CF2007 | Human Factor VIIa (Activated Factor 7) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CF1010 | Human Factor X (Factor 10) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CF2010 | Human Factor Xa (Activated Factor 10) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CP1100 | Human Plasminogen Activator Inhibitor-1 (PAI-1) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CT4010 | Human Thrombin Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CT1002b | Human Tissue Factor (TF) Chromogenic AssaySense Activity Assay Kit (Two step, Lipo) | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CT1001 | Human Tissue-type Plasminogen Activator (tPA) Chromogenic AssaySense Activity Assay Kit | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CU1001a | Human Urokinase (uPA) Chromogenic AssaySense Activity Assay Kit (Direct Assay) | Chromogenic Activity Assay | 96 Well Plate |
| Chromogenic | CU1001b | Human Urokinase (uPA) Chromogenic AssaySense Activity Assay Kit (Indirect Assay) | Chromogenic Activity Assay | 96 Well Plate |
| AssayLite | FEA2201 | Human Albumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEG5001 | Human alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEA5001 | Human alpha-1-Antitrypsin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEM2115 | Human alpha-2-Macroglobulin (A2M) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEA6501 | Human Amylase AssayLite Fluorescent Immunoassay Kit | Sandwich Fluorescent Assay | 96 Well Plate |
| AssayLite | FEA3303 | Human Antithrombin III (AT3) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEC4001 | Human Ceruloplasmin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEC2101 | Human Complement C3 AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEC2102 | Human Complement C4 AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEF1040 | Human Fibrinogen (FBG) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEF1045 | Human Fibronectin (FN) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEG3801 | Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEH1003 | Human Haptoglobin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEH1001 | Human Hemopexin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEI7001 | Human IgA AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEI7200 | Human IgG AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEI7301 | Human IgM AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEL1011 | Human Lactoferrin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEP2010 | Human Prealbumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FER1005 | Human Retinol-Binding Protein (RBP) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FET2105 | Human Transferrin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEKA2201 | Monkey Albumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEKI7100 | Monkey Immunoglobulin G (IgG) AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEMA2201 | Mouse Albumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FERA2201 | Rat Albumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FEPA2201 | Swine Albumin AssayLite Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FA320111M2 | Human Albumin and Rat Albumin AssayLite Multiplex Fluorescent Immunoassay Kit | Sandwich & Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FA500112M2 | Human alpha-1-Antitrypsin and Haptoglobin AssayLite Multiplex Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FA500111M2 | Human alpha-1-Antitrypsin and Prealbumin AssayLite Multiplex Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FAA3B2GP1 | Human beta-2 Glycoprotein 1 Antibodies, IgA, IgG and IgM AssayLite Multiplex Fluorescent Immunoassay Kit | Sandwich Fluorescent Assay | 96 Well Plate |
| AssayLite | FH100311M2 | Human Ceruloplasmin and Haptoglobin AssayLite Multiplex Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FC320161M2 | Human Complement C3 and Complement C4 AssayLite Multiplex Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| AssayLite | FH100361M2 | Human Fibrinogen (FBG) and Haptoglobin (HP) AssayLite Multiplex Fluorescent Immunoassay Kit | Competitive Fluorescent Assay | 96 Well Plate |
| FACS Kits | FACS33059M | Human ACAD8 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33003R | Human ACAT2 AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33518M | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS16951M | Human ADAMTS13 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS35692F | Human Adenine Phosphoribosyltransferase (APRT) AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS35692M | Human Adenine Phosphoribosyltransferase (APRT) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32180R | Human Adenylate Kinase 2 (AK 2) AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30030M | Human Adenylate Kinase 3 (AK 3) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32028R | Human Adenylate Kinase Isoenzyme 1 (AK 1) AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33145M | Human ADK AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32900M | Human ADPRH AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32922M | Human AHA1 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32569F | Human AKT1 AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32007M | Human Alcohol Dehydrogenase (AKR1A1) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32746M | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32088M | Human Aldolase C AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS12061F | Human Alpha-Synuclein AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32171M | Human Annexin A1 (ANXA1) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33118M | Human Annexin A3 (ANXA3) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30112M | Human Annexin A4 (ANXA4) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS35690M | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32855M | Human ARA9 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32618F | Human ATOX1 AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32116F | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33128A | Human BRD1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS13551F | Human C1QBP AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30256M | Human Calcium and Integrin-binding 1 (CIB1) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33189R | Human Calpain small subunit 1 AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS35681M | Human Casein Kinase 1 alpha (CK1 alpha) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33276M | Human Centromere Protein B (CENP-B) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33200A | Human COPS8 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33199R | Human CSK AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32053R | Human CtBP1 AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS35613M | Human Cystathionase AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32991M | Human Diazepam Binding Inhibitor AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32610A | Human Dihydrofolate Reductase (DHFR) AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32014M | Human Enolase 1 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32798A | Human FBP2 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS11321R | Human Ferritin (Liver) AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30005R | Human Galectin-1 (Gal-1) AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33370A | Human Glutathione Reductase AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33158F | Human GMF beta AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33171M | Human HB-EGF AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32265A | Human HBG2 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33107A | Human HspBP1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS24133M | Human Immunoglobulin G (IgG-Fab) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS24132M | Human Immunoglobulin G (IgG-Fc) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS34105M | Human Immunoglobulin G1-Fc (IgG1-Fc) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS24107M | Human Immunoglobulin G3 (IgG3) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS34107M | Human Immunoglobulin G3-Fc (IgG3-Fc) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS24108M | Human Immunoglobulin G4 (IgG4) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS34108M | Human Immunoglobulin G4-Fc (IgG4-Fc) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30165M | Human Immunoglobulin J Chain (IGJ) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30014M | Human Interferon Regulatory Factor 2 (IRF-2) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS31238M | Human Krueppel-like Factor 3 (KLF3) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32547A | Human LAP3 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS31398A | Human LPS-induced TNF-alpha Factor (LITAF) AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33106A | Human MDH1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33123A | Human MTCP1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32188A | Human Mucin-1 (MUC-1, CA 15-3) AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32189A | Human Mucin-16 (MUC-16, CA-125) AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS11552M | Human Myoglobin (Mb) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33084A | Human PCBD1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33091A | Human PDAP1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32551M | Human PEBP1 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32626F | Human Peroxiredoxin-2 (PRDX2) AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32706F | Human PPM1G AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32057F | Human Protein-Tyrosine Phosphatase 1B (PTP-1B) AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33100A | Human PRTFDC1 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS36157A | Human PTEN-Like Phosphatase (PTPMT1) AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33089A | Human Rab4 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32550R | Human RAC1 AssayLite RPE-Conjugated Antibody Flow Cytometry KitKit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33134A | Human RAD6 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32667A | Human RBBP9 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33109A | Human Shwachman Bodian-Diamond Syndrome AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30261F | Human Sialylated Lewis A Antigen (CA 19-9) AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32611M | Human SOD2 AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33144A | Human SQSTM1 / p62 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32670F | Human TGFBR2 AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS32251A | Human Thioredoxin / TRX AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS13016M | Human Thioredoxin-1 (TRX1) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33232F | Human Troponin C AssayLite FITC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33428A | Human UBE2J2 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33328R | Human UBL4A AssayLite RPE-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33403A | Human ULBP4 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33439A | Human USP14 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS33253A | Human WDR68 AssayLite APC-Conjugated Antibody Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| FACS Kits | FACS30022M | Pyruvate Dehydrogenase Complex (PDH Complex) AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit | Flow Cytometry Kit | Kit |
| ICC Kits | ICC33059R | Human ACAD8 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33003R | Human ACAT2 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33518R | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33392R | Human Acyl-coenzyme A Thioesterase 8 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC16951F | Human ADAMTS13 AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC35692F | Human Adenine Phosphoribosyltransferase (APRT) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC35692R | Human Adenine Phosphoribosyltransferase (APRT) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32180R | Human Adenylate Kinase 2 (AK 2) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC30030R | Human Adenylate Kinase 3 (AK 3) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33145F | Human ADK AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32900F | Human ADPRH AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32922F | Human AHA1 AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32569R | Human AKT1 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32007R | Human Alcohol Dehydrogenase (AKR1A1) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32746R | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32088R | Human Aldolase C AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC30112R | Human Annexin A4 (ANXA4) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC35690R | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32855R | Human ARA9 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32618F | Human ATOX1 AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32116F | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC13551F | Human C1QBP AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33189R | Human Calpain small subunit 1 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33063F | Human CAMK2N2 AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33199R | Human CSK AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32053R | Human CtBP1 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC35613R | Human Cystathionase AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32991R | Human Diazepam Binding Inhibitor AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32014R | Human Enolase 1 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC11321R | Human Ferritin (Liver) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC30005R | Human Galectin-1 (Gal-1) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33158F | Human GMF beta AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33171R | Human HB-EGF AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC30014F | Human Interferon Regulatory Factor 2 (IRF-2) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC11552R | Human Myoglobin (Mb) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32626F | Human Peroxiredoxin-2 (PRDX2) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32706F | Human PPM1G AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32057F | Human Protein-Tyrosine Phosphatase 1B (PTP-1B) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32550R | Human RAC1 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33134R | Human RAD6 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32611R | Human SOD2 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33144R | Human SQSTM1 / p62 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC32670F | Human TGFBR2 AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC13016F | Human Thioredoxin-1 (TRX1) AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33232F | Human Troponin C AssayLite FITC-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33328R | Human UBL4A AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC33253R | Human WDR68 AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| ICC Kits | ICC30022R | Pyruvate Dehydrogenase Complex (PDH Complex) AssayLite RPE-Conjugated Antibody ICC Kit | Immunocytochemistry (ICC) and Immunofluorescence (IF) Kit | Kit |
| Negative Control | CEA25002 | Human Adiponectin (ACRP30) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEG50012 | Human Alpha-1-Acid Glycoprotein AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA50012 | Human Alpha-1-Antitrypsin AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA51012 | Human Alpha-1-Antitrypsin AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA33012 | Human Antithrombin III (AT3) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA33032 | Human Antithrombin III (AT3) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA80122 | Human Apolipoprotein C-II (Apo C2) AssayMax ELISA Kit Low (Negative) Reference Plasma Control | Control | Vial |
| Negative Control | CEA88212 | Human Apolipoprotein H (Apo H, B2GP1) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC10012 | Human C-Reactive Protein (CRP) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC11012 | Human Complement C1q AssayMax ELISA Kit Low (Negative) Reference Plasma Control | Control | Vial |
| Negative Control | CEC20012 | Human Complement C2 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC21012 | Human Complement C3 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC33012 | Human Complement C3b AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC21022 | Human Complement C4 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC32022 | Human Complement C4 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC51012 | Human Complement C5 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC81012 | Human Complement C8 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEC91012 | Human Complement C9 AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF70012 | Human Complement Factor B AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF77012 | Human Complement Factor D AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF70552 | Human Complement Factor H AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10092 | Human Factor IX AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10052 | Human Factor V AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10072 | Human Factor VII AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF20072 | Human Factor VII AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10102 | Human Factor X AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10112 | Human Factor XI AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10122 | Human Factor XII AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10132 | Human Factor XIII AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF20032 | Human Ferritin AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF10452 | Human Fibronectin (FN) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEF20452 | Human Fibronectin (FN) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEG38012 | Human Gc-Globulin AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEI72012 | Human Immunoglobulin G3 (IgG3) AssayMax ELISA Kit Low Control | Control | Vial |
| Negative Control | CEP12002 | Human Plasminogen (PLG) AssayMax ELISA Kit Low Control | Control | Vial |
| Negative Control | SEP3010-1 | Human Prealbumin (Transthyretin, TTR) AssayMax ELISA Kit Standard | Standard | Vial |
| Negative Control | CEK21112 | Human Prekallikrein (PK) AssayMax ELISA Kit Low Reference Plasma Control | Control | Vial |
| Negative Control | CEP13112 | Human Protein C AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEP13312 | Human Protein S AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA80012 | Human Serum Amyloid A (SAA) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEA82012 | Human Serum Amyloid P Component (SAP) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CET10012 | Human tPA AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Negative Control | CEV20302 | Human Von Willebrand Factor (VWF) AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Positive Control | CEA25501 | Human ADAMTS13 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA25001 | Human Adiponectin (ACRP30) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA22011 | Human Albumin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA32011 | Human Albumin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG51012 | Human Alpha-1-Acid Glycoprotein AssayMax ELISA Kit Low (Negative) Reference Control | Control | Vial |
| Positive Control | CEG50011 | Human Alpha-1-Acid Glycoprotein AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG51011 | Human Alpha-1-Acid Glycoprotein AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA55011 | Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA50011 | Human Alpha-1-Antitrypsin AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEA51011 | Human Alpha-1-Antitrypsin AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEM51101 | Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEM11151 | Human Alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEM21151 | Human Alpha-2-Macroglobulin (A2M) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF60111 | Human Alpha-Fetoprotein (AFP) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA58011 | Human Amyloid Precursor Protein (APP) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA36121 | Human Annexin A1 (ANXA1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA36511 | Human Annexin A10 (ANXA10) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA36031 | Human Annexin A3 (ANXA3) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA36011 | Human Annexin A5 (ANXA5) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA33031 | Human Antithrombin III (AT3) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA33011 | Human Antithrombin III (AT3) AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | SEA3301 | Human Antithrombin III (AT3) AssayMax ELISA Kit Standard | Standard | Vial |
| Positive Control | CEA52011 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA53011 | Human Apolipoprotein A-I (Apo A1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA52221 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA53331 | Human Apolipoprotein A-II (Apo A2) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA70011 | Human Apolipoprotein B (Apo B) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA801121 | Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA80121 | Human Apolipoprotein C-II (Apo C2) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA81331 | Human Apolipoprotein C-III (Apo C3) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA80031 | Human Apolipoprotein E (Apo E) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA88211 | Human Apolipoprotein H (Apo H, B2GP1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA81211 | Human Azurocidin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEM50011 | Human Beta-2-Microglobulin (B2M) AssayMax ELISA Kit Positive Reference Plasma Control Calibrated against WHO Standard | Control | Vial |
| Positive Control | CEC10011 | Human C-Reactive Protein (CRP) AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEC31031 | Human Calprotectin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC32371 | Human Cathepsin G AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CEC42011 | Human Ceruloplasmin (CP) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC11111 | Human Complement C1 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC11011 | Human Complement C1q AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC11021 | Human Complement C1r AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC20011 | Human Complement C2 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC21011 | Human Complement C3 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC32011 | Human Complement C3 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC33011 | Human Complement C3b AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC33311 | Human Complement C3d AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC21021 | Human Complement C4 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC32021 | Human Complement C4 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC22021 | Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC51011 | Human Complement C5 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC61011 | Human Complement C6 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC71011 | Human Complement C7 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC81011 | Human Complement C8 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC81201 | Human Complement C8 Gamma (C8G) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC91011 | Human Complement C9 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF70011 | Human Complement Factor B AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF77011 | Human Complement Factor D AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF70551 | Human Complement Factor H AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF80051 | Human Complement Factor I AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF80111 | Human Complement Factor P AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC23011 | Human Cystatin-B (CSTB) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC25021 | Human Cystatin-C (CST3) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC24211 | Human Cystatin-D (CST5) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEC24421 | Human Cystatin-S (CST4) AssayMax ELISA Kit AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEE10011 | Human Elastase (Neutrophil ELA2) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEE22311 | Human Eosinophil Peroxidase (EPO) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF10091 | Human Factor IX AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10051 | Human Factor V AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10071 | Human Factor VII AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF20071 | Human Factor VII AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10081 | Human Factor VIII AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10101 | Human Factor X AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF101021 | Human Factor X AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10111 | Human Factor XI AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF10121 | Human Factor XII AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF10131 | Human Factor XIII AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF27021 | Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF27051 | Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF20031 | Human Ferritin AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEG35011 | Human Fetuin-A (Alpha-2-HS-Glycoprotein) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF20401 | Human Fibrinogen (FBG) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF104021 | Human Fibrinogen (FBG) AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEF30211 | Human Fibroblast Growth Factor 21 (FGF-21) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF10451 | Human Fibronectin (FN) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEF20451 | Human Fibronectin (FN) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG38011 | Human Gc-Globulin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG37801 | Human Ghrelin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG10011 | Human Glucokinase (Hexokinase-4) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG51331 | Human Glycyl-tRNA Synthetase (GARS) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA76521 | Human GOT2 AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEG10601 | Human GPIIbIIIa AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEH10031 | Human Haptoglobin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEH10011 | Human Hemopexin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEH20011 | Human Hemopexin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEI70011 | Human Immunoglobulin A (IgA) AssayMax ELISA Kit Positive Reference Plasma Control Calibrated against WHO Standard | Control | Vial |
| Positive Control | CEI72001 | Human Immunoglobulin G (IgG) AssayMax ELISA Kit WHO Calibrated Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEI72011 | Human Immunoglobulin G3 (IgG3) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEI73011 | Human Immunoglobulin M (IgM) AssayMax ELISA Kit WHO Calibrated Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEI10011 | Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEI22001 | Human Interleukin-1 beta AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CEI10061 | Human Interleukin-6 (IL-6) AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CEK10011 | Human Kininogen (HMW) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL10111 | Human Lactoferrin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL20111 | Human Lactoferrin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL20011 | Human Leptin AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEL23011 | Human Leucine-rich alpha-2-Glycoprotein (LRG1) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL30011 | Human Lipoprotein a [Lp(a)] AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL30101 | Human Lysozyme AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEL30201 | Human Lysozyme AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEM65011 | Human Myeloperoxidase (MPO) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEA65011 | Human Pancreatic Amylase AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP12001 | Human Plasminogen (PLG) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP11001 | Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit Positive Reference Control | Control | Vial |
| Positive Control | CEP30101 | Human Prealbumin (Transthyretin, TTR) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEK21111 | Human Prekallikrein (PK) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP13111 | Human Protein C AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP23121 | Human Protein C AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP13311 | Human Protein S AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEP33331 | Human Protein Z AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP23311 | Human Proteinase 3 (PR3, cANCA) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEP30231 | Human Prothrombin (Factor II) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CER10011 | Human Resistin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CER10051 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CER20051 | Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CER30051 | Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CEA80011 | Human Serum Amyloid A (SAA) AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CEA82011 | Human Serum Amyloid P Component (SAP) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET10201 | Human Thrombin-Antithrombin Complex (TAT) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET10021 | Human Tissue Factor (TF) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET10051 | Human Tissue Factor Pathway Inhibitor (TFPI) AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET20101 | Human TNF-alpha AssayMax ELISA Kit Positive Control | Control | Vial |
| Positive Control | CET10011 | Human tPA AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET20011 | Human tPA AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Positive Control | CET21051 | Human Transferrin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CET31051 | Human Transferrin AssayMax ELISA Kit Positive Reference Plasma Control | Control | Vial |
| Positive Control | CEV20301 | Human Von Willebrand Factor (VWF) AssayMax ELISA Kit Positive Reference Plasma Control (Calibrated against WHO Standard) | Control | Vial |
| Monoclonal Primary Abs | 65361-05111 | Human Adiponectin (ACRP30) Monoclonal Antibody | IgG | 50 ug |
| Monoclonal Primary Abs | 65361-05121 | Human Adiponectin (ACRP30) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 50 ug |
| Monoclonal Primary Abs | 65361-05141 | Human Adiponectin (ACRP30) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60111-05111 | Human alpha-Thrombin Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60111-05121 | Human alpha-Thrombin Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60111-05141 | Human alpha-Thrombin Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 61772-05111 | Human Antithrombin III (AT3) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65008-05111 | Human Antithrombin III (AT3) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 61772-05121 | Human Antithrombin III (AT3) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65008-05121 | Human Antithrombin III (AT3) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 61772-05141 | Human Antithrombin III (AT3) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65008-05141 | Human Antithrombin III (AT3) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 63581-05111 | Human Apolipoprotein C-III (Apo C3) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 63581-05121 | Human Apolipoprotein C-III (Apo C3) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 63581-05141 | Human Apolipoprotein C-III (Apo C3) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 78006-05141 | Human CD14 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70078-05141 | Human CD209 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70098-05141 | Human CD28 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70025-05141 | Human CD3 epsilon AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70029-05141 | Human CD314 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 78002-05141 | Human CD4 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 78010-05141 | Human CD71 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60231-05111 | Human Complement C3 Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60231-05121 | Human Complement C3 Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60231-05141 | Human Complement C3 Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60481-05111 | Human Complement C4 Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60481-05121 | Human Complement C4 Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60481-05141 | Human Complement C4 Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65020-05111 | Human Complement C4-Binding Protein (C4BP) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65020-05121 | Human Complement C4-Binding Protein (C4BP) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65020-05141 | Human Complement C4-Binding Protein (C4BP) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 61180-05111 | Human Complement C5 Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 61180-05121 | Human Complement C5 Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 61180-05141 | Human Complement C5 Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 61482-05111 | Human Complement C6 Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 61482-05121 | Human Complement C6 Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 61482-05141 | Human Complement C6 Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70028-05141 | Human CXCL12 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70018-05141 | Human CXCR2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70034-05141 | Human CXCR3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60284-05111 | Human Factor IX (Factor 9) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60284-05121 | Human Factor IX (Factor 9) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60284-05141 | Human Factor IX (Factor 9) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65001-05111 | Human Factor V (Factor 5) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65001-05121 | Human Factor V (Factor 5) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65001-05141 | Human Factor V (Factor 5) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65002-05111 | Human Factor VIIa (Factor 7a) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65002-05121 | Human Factor VIIa (Factor 7a) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65002-05141 | Human Factor VIIa (Factor 7a) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65003-05111 | Human Factor VIII (Factor 8) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65003-05121 | Human Factor VIII (Factor 8) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65003-05141 | Human Factor VIII (Factor 8) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65004-05111 | Human Factor X (Factor 10) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65005-05111 | Human Factor X (Factor 10) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65004-05121 | Human Factor X (Factor 10) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65005-05121 | Human Factor X (Factor 10) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65004-05141 | Human Factor X (Factor 10) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65005-05141 | Human Factor X (Factor 10) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60788-05111 | Human Factor XIa (Factor 11a) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60788-05121 | Human Factor XIa (Factor 11a) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60788-05141 | Human Factor XIa (Factor 11a) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65006-05111 | Human Factor XII (Factor 12) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65006-05121 | Human Factor XII (Factor 12) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65006-05141 | Human Factor XII (Factor 12) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60398-05111 | Human Factor XIII (Factor 13) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60398-05121 | Human Factor XIII (Factor 13) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60398-05141 | Human Factor XIII (Factor 13) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65007-05111 | Human Factor XIIIb (Factor 13b) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65007-05121 | Human Factor XIIIb (Factor 13b) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65007-05141 | Human Factor XIIIb (Factor 13b) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65033-05111 | Human Fibrinogen (FBG) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65033-05121 | Human Fibrinogen (FBG) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65033-05141 | Human Fibrinogen (FBG) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 78013-05141 | Human HLA-B7 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70128-05141 | Human IFN-gamma AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70039-05141 | Human IL-1 beta AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70228-05141 | Human IL-2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70011-05141 | Human IL-6 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70021-05141 | Human IL-8 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 61011-05111 | Human Kininogen (LMW) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 61011-05121 | Human Kininogen (LMW) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 61011-05141 | Human Kininogen (LMW) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65015-05111 | Human Plasminogen (PLG) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65040-05111 | Human Plasminogen (PLG) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65041-05111 | Human Plasminogen (PLG) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65042-05111 | Human Plasminogen (PLG) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65015-05121 | Human Plasminogen (PLG) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65040-05121 | Human Plasminogen (PLG) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65041-05121 | Human Plasminogen (PLG) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65042-05121 | Human Plasminogen (PLG) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65015-05141 | Human Plasminogen (PLG) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65040-05141 | Human Plasminogen (PLG) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65041-05141 | Human Plasminogen (PLG) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65042-05141 | Human Plasminogen (PLG) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65010-05111 | Human Protein C Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65010-05121 | Human Protein C Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65010-05141 | Human Protein C Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65009-05111 | Human Prothrombin (Factor II) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65009-05121 | Human Prothrombin (Factor II) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65009-05141 | Human Prothrombin (Factor II) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60180-05111 | Human Serum Amyloid A (SAA) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60180-05121 | Human Serum Amyloid A (SAA) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60180-05141 | Human Serum Amyloid A (SAA) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65011-05111 | Human Tissue Factor (TF) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65011-05121 | Human Tissue Factor (TF) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65011-05141 | Human Tissue Factor (TF) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65101-05111 | Human Tissue-type Plasminogen Activator (tPA) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65101-05121 | Human Tissue-type Plasminogen Activator (tPA) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65101-05141 | Human Tissue-type Plasminogen Activator (tPA) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70032-05141 | Human VEGF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65017-05111 | Human Vitronectin (VTN) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65017-05121 | Human Vitronectin (VTN) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65017-05141 | Human Vitronectin (VTN) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 65012-05111 | Human Von Willebrand Factor (VWF) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 65012-05121 | Human Von Willebrand Factor (VWF) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 65012-05141 | Human Von Willebrand Factor (VWF) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70027-05141 | Mouse CXCL1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70058-05141 | Mouse G-CSF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | MAPCCON | Mouse IgG Isotype Control APC Conjugate | Fluorescent Label | 0.15 mg |
| Monoclonal Primary Abs | MFITCCON | Mouse IgG Isotype Control FITC Conjugate | Fluorescent Label | 0.15 mg |
| Monoclonal Primary Abs | MPERCPCON | Mouse IgG Isotype Control PerCP Conjugate | Fluorescent Label | 0.15 mg |
| Monoclonal Primary Abs | MRPECON | Mouse IgG Isotype Control RPE Conjugate | Fluorescent Label | 0.15 mg |
| Monoclonal Primary Abs | 70068-05141 | Mouse IL-10 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70023-05141 | Mouse IL-17 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 70017-05141 | Mouse IL-6 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Primary Abs | 60150-05111 | Rabbit Albumin Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Primary Abs | 60150-05121 | Rabbit Albumin Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Primary Abs | 60150-05141 | Rabbit Albumin Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Secondary Abs | 60146-05111 | Human Immunoglobulin G1 (IgG1-Fc) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Secondary Abs | 60146-05121 | Human Immunoglobulin G1 (IgG1-Fc) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Secondary Abs | 60146-05141 | Human Immunoglobulin G1 (IgG1-Fc) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Monoclonal Secondary Abs | 60145-05111 | Human Immunoglobulin G3 (IgG3) Monoclonal Antibody | IgG | 100 ug |
| Monoclonal Secondary Abs | 60145-05121 | Human Immunoglobulin G3 (IgG3) Monoclonal Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 100 ug |
| Monoclonal Secondary Abs | 60145-05141 | Human Immunoglobulin G3 (IgG3) Monoclonal AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 50 ug |
| Polyclonal Primary Abs | 32011-05111 | Human GNPDA 1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32011-05121 | Human GNPDA 1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32011-05161 | Human GNPDA 1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32011-05141 | Human GNPDA 1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32011-05171 | Human GNPDA 1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32011-05151 | Human GNPDA 1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10282-05011 | 1-Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10283-05011 | 1-Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10981-05011 | 1-Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10982-05011 | 1-Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33051-05111 | 11 alpha-Hydroxyandrostenedione Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10311-05011 | 11 alpha-Hydroxytestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10321-05011 | 11-Ketotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36842-05111 | 11-Ketotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10351-05011 | 17 alpha, 20 beta-DIHYDROXYPROGESTERONE Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10294-05111 | 17 alpha-Methyltestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10295-05111 | 17 alpha-Methyltestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10261-05011 | 17-Hydroxyprogesterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36843-05111 | 17-Hydroxyprogesterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10331-05011 | 19-Nortestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10271-05011 | 20-alpha-Hydroxyprogesterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11691-05011 | 3-Keto-5 alpha,16-Androstene (Androstenone) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10051-05011 | 4-Androsten-17 alpha-OL-3-One (Epitestosterone) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10791-05011 | 5 beta-Dihydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10792-05011 | 5 beta-Dihydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10071-05011 | 5-Androsten-3 beta-OL-7, 17-Dione (DHEA) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10251-05011 | 6 beta-Hydroxyprogesterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10292-05111 | 6 Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10293-05111 | 6 Dehydrotestosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10181-05011 | 6-Keto-17 alpha-Estradiol Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10191-05011 | 6-Keto-17 beta- Estradiol Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10201-05011 | 6-Ketoestriol Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10221-05011 | 6-Ketoestrone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10241-05011 | 7 alpha-Progesterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10381-05011 | Adrenorphin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10381-05021 | Adrenorphin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10011-05011 | Aldosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10021-05011 | Aldosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10022-05011 | Aldosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 41011-05011 | Aldosterone Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 10031-05011 | Aldosterone Diacetate Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10391-05011 | Allatostatin 1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10391-05021 | Allatostatin 1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10401-05011 | Allatostatin 2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10401-05021 | Allatostatin 2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10411-05011 | Allatostatin 3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10411-05021 | Allatostatin 3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10421-05011 | Allatostatin 4 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10421-05021 | Allatostatin 4 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10041-05011 | Allopregnanolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36844-05111 | Allopregnanolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36845-05111 | Allopregnanolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36846-05111 | Allopregnanolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36847-05111 | Allopregnanolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10741-05011 | alpha-Endorphin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10741-05021 | alpha-Endorphin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33052-05111 | Androstenedione Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11112-05011 | Arginine Vasopressin ([Arg8] Vasopressin) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11112-05021 | Arginine Vasopressin ([Arg8] Vasopressin) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10491-05011 | Atriopeptin II Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10491-05021 | Atriopeptin II Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10481-05011 | Atriopeptin III Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10481-05021 | Atriopeptin III Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12005-05011 | Bovine Albumin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12005-05021 | Bovine Albumin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12005-05061 | Bovine Albumin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12005-05041 | Bovine Albumin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12005-05071 | Bovine Albumin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12005-05051 | Bovine Albumin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22111-05011 | Bovine Antithrombin III (AT III) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22111-05021 | Bovine Antithrombin III (AT III) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10611-05011 | Bovine beta-Casomorphin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10611-05021 | Bovine beta-Casomorphin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33492-05111 | Bovine Calmodulin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33492-05121 | Bovine Calmodulin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33492-05161 | Bovine Calmodulin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33492-05141 | Bovine Calmodulin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33492-05171 | Bovine Calmodulin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33492-05151 | Bovine Calmodulin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22266-05011 | Bovine Factor X Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22266-05021 | Bovine Factor X Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22266-05061 | Bovine Factor X AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22266-05041 | Bovine Factor X AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 22266-05071 | Bovine Factor X AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22266-05051 | Bovine Factor X AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22262-05011 | Bovine Factor XIa Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22262-05021 | Bovine Factor XIa Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 21255-05011 | Bovine Fibrinogen (FBG) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 21255-05021 | Bovine Fibrinogen (FBG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 21255-05061 | Bovine Fibrinogen (FBG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 21255-05041 | Bovine Fibrinogen (FBG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 21255-05071 | Bovine Fibrinogen (FBG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 21255-05051 | Bovine Fibrinogen (FBG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11361-05011 | Bovine Folate Binding Protein (FBP, FR-alpha) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11361-05021 | Bovine Folate Binding Protein (FBP, FR-alpha) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11361-05041 | Bovine Folate Binding Protein (FBP, FR-alpha) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 15751-05011 | Bovine Haptoglobin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 15751-05021 | Bovine Haptoglobin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 15751-05041 | Bovine Haptoglobin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36848-05111 | Bovine Myoglobin (Mb) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36848-05121 | Bovine Myoglobin (Mb) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11495-05011 | Bovine Plasminogen (PLG) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11495-05021 | Bovine Plasminogen (PLG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11495-05061 | Bovine Plasminogen (PLG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11495-05041 | Bovine Plasminogen (PLG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11495-05071 | Bovine Plasminogen (PLG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11495-05051 | Bovine Plasminogen (PLG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22545-05011 | Bovine Protein C Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22545-05021 | Bovine Protein C Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22545-05041 | Bovine Protein C AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33250-05111 | Bovine SNRP70 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33250-05121 | Bovine SNRP70 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33250-05161 | Bovine SNRP70 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33250-05141 | Bovine SNRP70 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33250-05171 | Bovine SNRP70 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33250-05151 | Bovine SNRP70 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10561-05011 | Bradykinin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10561-05021 | Bradykinin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32878-05111 | C. elegans SNAP25 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32878-05121 | C. elegans SNAP25 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32878-05161 | C. elegans SNAP25 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32878-05141 | C. elegans SNAP25 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32878-05171 | C. elegans SNAP25 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32878-05151 | C. elegans SNAP25 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33344-05161 | Canine Interferon gamma (IFN-gamma) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33344-05151 | Canine Interferon gamma (IFN-gamma) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12105-05011 | Canine Albumin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12105-05021 | Canine Albumin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12105-05061 | Canine Albumin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12105-05041 | Canine Albumin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12105-05071 | Canine Albumin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12105-05051 | Canine Albumin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 14078-05011 | Canine Apotransferrin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 14078-05021 | Canine Apotransferrin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11922-05011 | Canine C-Reactive Protein (CRP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11922-05021 | Canine C-Reactive Protein (CRP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11922-05061 | Canine C-Reactive Protein (CRP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11922-05041 | Canine C-Reactive Protein (CRP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11922-05071 | Canine C-Reactive Protein (CRP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11922-05051 | Canine C-Reactive Protein (CRP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 21251-05011 | Canine Fibrinogen (FBG) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 21251-05021 | Canine Fibrinogen (FBG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 21251-05061 | Canine Fibrinogen (FBG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 21251-05041 | Canine Fibrinogen (FBG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 21251-05071 | Canine Fibrinogen (FBG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 21251-05051 | Canine Fibrinogen (FBG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 15551-05011 | Canine Haptoglobin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 15551-05021 | Canine Haptoglobin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 15551-05041 | Canine Haptoglobin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33344-05111 | Canine Interferon gamma (IFN-gamma) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33344-05121 | Canine Interferon gamma (IFN-gamma) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33344-05141 | Canine Interferon gamma (IFN-gamma) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33344-05171 | Canine Interferon gamma (IFN-gamma) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 14082-05011 | Canine Myoglobin (Mb) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 14082-05021 | Canine Myoglobin (Mb) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 14082-05041 | Canine Myoglobin (Mb) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 13133-05011 | Canine Retinol-Binding Protein 4 (RBP4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 13133-05021 | Canine Retinol-Binding Protein 4 (RBP4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 13133-05061 | Canine Retinol-Binding Protein 4 (RBP4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 13133-05041 | Canine Retinol-Binding Protein 4 (RBP4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 13133-05071 | Canine Retinol-Binding Protein 4 (RBP4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 13133-05051 | Canine Retinol-Binding Protein 4 (RBP4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10591-05011 | Cardiodilatin (1-16) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10591-05021 | Cardiodilatin (1-16) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33113-05111 | Collagen alpha-3(IV) Chain (GBM) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33113-05121 | Collagen alpha-3(IV) Chain (GBM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33113-05161 | Collagen alpha-3(IV) Chain (GBM) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33113-05141 | Collagen alpha-3(IV) Chain (GBM) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33113-05171 | Collagen alpha-3(IV) Chain (GBM) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33113-05151 | Collagen alpha-3(IV) Chain (GBM) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10061-05011 | Cortexolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36840-05111 | Cortexolone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 40061-05011 | Cortexolone Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 10091-05011 | Corticosterone 21-Acetate Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10101-05011 | Corticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10102-05011 | Corticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10103-05011 | Corticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10104-05011 | Corticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10121-05011 | Corticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 40101-05011 | Corticosterone Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 10141-05011 | Cortisol Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 40141-05011 | Cortisol Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 10151-05011 | Cortisone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10651-05011 | Cortistatin 14 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10671-05011 | Cortistatin 29 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10671-05021 | Cortistatin 29 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32273-05111 | Dengue Virus 2 Envelope Protein (DENV) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32273-05121 | Dengue Virus 2 Envelope Protein (DENV) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32273-05161 | Dengue Virus 2 Envelope Protein (DENV) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32273-05141 | Dengue Virus 2 Envelope Protein (DENV) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32273-05171 | Dengue Virus 2 Envelope Protein (DENV) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32273-05151 | Dengue Virus 2 Envelope Protein (DENV) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10131-05011 | Deoxycorticosterone Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10291-05011 | Dihydrotestosterone (DHT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10301-05011 | Dihydrotestosterone (DHT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30267-05111 | DNA Topoisomerase I (TOP1, Scl-70) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30267-05121 | DNA Topoisomerase I (TOP1, Scl-70) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30267-05161 | DNA Topoisomerase I (TOP1, Scl-70) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30267-05141 | DNA Topoisomerase I (TOP1, Scl-70) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30267-05171 | DNA Topoisomerase I (TOP1, Scl-70) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30267-05151 | DNA Topoisomerase I (TOP1, Scl-70) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10701-05011 | Dynorphin A (1-17) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10701-05021 | Dynorphin A (1-17) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10711-05011 | Dynorphin B (1-9) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10711-05021 | Dynorphin B (1-9) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30109-05111 | E. coli Carbonic Anhydrase 2 (CA2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30109-05121 | E. coli Carbonic Anhydrase 2 (CA2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30109-05161 | E. coli Carbonic Anhydrase 2 (CA2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30109-05141 | E. coli Carbonic Anhydrase 2 (CA2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30109-05171 | E. coli Carbonic Anhydrase 2 (CA2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30109-05151 | E. coli Carbonic Anhydrase 2 (CA2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30281-05111 | E. coli CysH Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30281-05121 | E. coli CysH Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30281-05161 | E. coli CysH AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30281-05141 | E. coli CysH AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30281-05171 | E. coli CysH AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30281-05151 | E. coli CysH AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32936-05111 | E. coli deoC Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32936-05121 | E. coli deoC Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32936-05161 | E. coli deoC AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32936-05141 | E. coli deoC AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32936-05171 | E. coli deoC AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32936-05151 | E. coli deoC AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32022-05111 | E. coli DnaJ Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32022-05121 | E. coli DnaJ Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32022-05161 | E. coli DnaJ AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32022-05141 | E. coli DnaJ AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32022-05171 | E. coli DnaJ AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32022-05151 | E. coli DnaJ AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32857-05111 | E. coli DnaK (1-384 aa) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32857-05121 | E. coli DnaK (1-384 aa) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32857-05161 | E. coli DnaK (1-384 aa) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32857-05141 | E. coli DnaK (1-384 aa) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32857-05171 | E. coli DnaK (1-384 aa) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32857-05151 | E. coli DnaK (1-384 aa) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32859-05111 | E. coli DnaK (385-638 aa) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32859-05121 | E. coli DnaK (385-638 aa) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32859-05161 | E. coli DnaK (385-638 aa) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32859-05141 | E. coli DnaK (385-638 aa) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32859-05171 | E. coli DnaK (385-638 aa) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32859-05151 | E. coli DnaK (385-638 aa) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32984-05111 | E. Coli DnaK (508-638 aa) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32984-05121 | E. Coli DnaK (508-638 aa) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32984-05161 | E. Coli DnaK (508-638 aa) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32984-05141 | E. Coli DnaK (508-638 aa) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32984-05171 | E. Coli DnaK (508-638 aa) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32984-05151 | E. Coli DnaK (508-638 aa) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36830-05111 | E. coli DSBC Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36830-05121 | E. coli DSBC Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36830-05161 | E. coli DSBC AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36830-05141 | E. coli DSBC AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36830-05171 | E. coli DSBC AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36830-05151 | E. coli DSBC AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32864-05111 | E. coli GLK Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32864-05121 | E. coli GLK Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32864-05161 | E. coli GLK AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32864-05141 | E. coli GLK AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32864-05171 | E. coli GLK AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32864-05151 | E. coli GLK AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32699-05111 | E. coli Glycerol Kinase Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32699-05121 | E. coli Glycerol Kinase Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32699-05161 | E. coli Glycerol Kinase AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32699-05141 | E. coli Glycerol Kinase AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32699-05171 | E. coli Glycerol Kinase AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32699-05151 | E. coli Glycerol Kinase AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32540-05111 | E. coli GOR Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32540-05121 | E. coli GOR Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32540-05161 | E. coli GOR AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32540-05141 | E. coli GOR AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32540-05171 | E. coli GOR AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32540-05151 | E. coli GOR AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20012-05011 | E. coli GroEL Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 20012-05021 | E. coli GroEL Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 20012-05061 | E. coli GroEL AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20012-05041 | E. coli GroEL AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 20012-05071 | E. coli GroEL AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20012-05051 | E. coli GroEL AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32898-05111 | E. Coli lDHA Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32898-05121 | E. Coli lDHA Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32898-05161 | E. Coli lDHA AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32898-05141 | E. Coli lDHA AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32898-05171 | E. Coli lDHA AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32898-05151 | E. Coli lDHA AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35738-05111 | E. coli Maltose Binding Protein (MBP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35738-05121 | E. coli Maltose Binding Protein (MBP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35738-05161 | E. coli Maltose Binding Protein (MBP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35738-05141 | E. coli Maltose Binding Protein (MBP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35738-05171 | E. coli Maltose Binding Protein (MBP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35738-05151 | E. coli Maltose Binding Protein (MBP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30283-05111 | E. coli Methionine Aminopeptidase (MAP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30283-05121 | E. coli Methionine Aminopeptidase (MAP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30283-05161 | E. coli Methionine Aminopeptidase (MAP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30283-05141 | E. coli Methionine Aminopeptidase (MAP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30283-05171 | E. coli Methionine Aminopeptidase (MAP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30283-05151 | E. coli Methionine Aminopeptidase (MAP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33092-05111 | E. coli nanA Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33092-05121 | E. coli nanA Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33092-05161 | E. coli nanA AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33092-05141 | E. coli nanA AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33092-05171 | E. coli nanA AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33092-05151 | E. coli nanA AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32662-05111 | E. coli NDK Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32662-05121 | E. coli NDK Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32662-05161 | E. coli NDK Antibody AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32662-05141 | E. coli NDK Antibody AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32662-05171 | E. coli NDK Antibody AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32662-05151 | E. coli NDK Antibody AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32678-05111 | E. coli PPA Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32678-05121 | E. coli PPA Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32678-05161 | E. coli PPA AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32678-05141 | E. coli PPA AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32678-05171 | E. coli PPA AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32678-05151 | E. coli PPA AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32163-05111 | E. coli PYKF Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32163-05121 | E. coli PYKF Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32163-05161 | E. coli PYKF AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32163-05141 | E. coli PYKF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32163-05171 | E. coli PYKF AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32163-05151 | E. coli PYKF AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32971-05111 | E. coli SKP Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32971-05121 | E. coli SKP Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32971-05161 | E. coli SKP AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32971-05141 | E. coli SKP AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32971-05171 | E. coli SKP AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32971-05151 | E. coli SKP AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30291-05111 | E. coli Superoxide Dismutase (SodA, MnSOD) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30291-05121 | E. coli Superoxide Dismutase (SodA, MnSOD) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30291-05161 | E. coli Superoxide Dismutase (SodA, MnSOD) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30291-05141 | E. coli Superoxide Dismutase (SodA, MnSOD) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30291-05171 | E. coli Superoxide Dismutase (SodA, MnSOD) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30291-05151 | E. coli Superoxide Dismutase (SodA, MnSOD) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30258-05111 | E. coli Thiol Peroxidase (TPX) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30258-05121 | E. coli Thiol Peroxidase (TPX) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30258-05161 | E. coli Thiol Peroxidase (TPX) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30258-05141 | E. coli Thiol Peroxidase (TPX) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30258-05171 | E. coli Thiol Peroxidase (TPX) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30258-05151 | E. coli Thiol Peroxidase (TPX) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32023-05111 | E. coli Thioredoxin Reductase (TRXB) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32023-05121 | E. coli Thioredoxin Reductase (TRXB) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32023-05161 | E. coli Thioredoxin Reductase (TRXR) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32023-05141 | E. coli Thioredoxin Reductase (TRXR) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32023-05171 | E. coli Thioredoxin Reductase (TRXR) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32023-05151 | E. coli Thioredoxin Reductase (TRXR) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33517-05111 | E. coli Tryptophanase (Tnase) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33517-05121 | E. coli Tryptophanase (Tnase) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33517-05161 | E. coli Tryptophanase (Tnase) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33517-05141 | E. coli Tryptophanase (Tnase) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33517-05171 | E. coli Tryptophanase (Tnase) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33517-05151 | E. coli Tryptophanase (Tnase) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30338-05111 | E. coli Uridine Phosphorylase (UPase) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30338-05121 | E. coli Uridine Phosphorylase (UPase) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30338-05161 | E. coli Uridine Phosphorylase (UPase) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30338-05141 | E. coli Uridine Phosphorylase (UPase) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30338-05171 | E. coli Uridine Phosphorylase (UPase) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30338-05151 | E. coli Uridine Phosphorylase (UPase) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33115-05111 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33115-05121 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33115-05161 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33115-05141 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33115-05171 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33115-05151 | E.coli Glucose-6-Phosphate 1-Dehydrogenase (G6PD) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31386-05111 | E.coli Glutaminase 1 (glsA1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31386-05121 | E.coli Glutaminase 1 (glsA1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31386-05161 | E.coli Glutaminase 1 (glsA1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31386-05141 | E.coli Glutaminase 1 (glsA1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31386-05171 | E.coli Glutaminase 1 (glsA1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31386-05151 | E.coli Glutaminase 1 (glsA1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35145-05111 | E.coli Glycerol Dehydrogenase (GLDA) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35145-05121 | E.coli Glycerol Dehydrogenase (GLDA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35145-05161 | E.coli Glycerol Dehydrogenase (GLDA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35145-05141 | E.coli Glycerol Dehydrogenase (GLDA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35145-05171 | E.coli Glycerol Dehydrogenase (GLDA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35145-05151 | E.coli Glycerol Dehydrogenase (GLDA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33116-05111 | E.coli IDNK Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33116-05121 | E.coli IDNK Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33116-05161 | E.coli IDNK AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33116-05141 | E.coli IDNK AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33116-05171 | E.coli IDNK AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33116-05151 | E.coli IDNK AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10721-05011 | Endomorphin-1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10721-05021 | Endomorphin-1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10731-05011 | Endomorphin-2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10731-05021 | Endomorphin-2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10211-05011 | Ethynylestradiol Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10831-05011 | Exendin-3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10831-05021 | Exendin-3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10841-05011 | Exendin-4 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10841-05021 | Exendin-4 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10891-05011 | Galantide Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10891-05021 | Galantide Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10751-05011 | gamma-Endorphin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10751-05021 | gamma-Endorphin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33487-05111 | Genome Polyprotein (HCV-Core) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33487-05121 | Genome Polyprotein (HCV-Core) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33487-05161 | Genome Polyprotein (HCV-Core) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33487-05141 | Genome Polyprotein (HCV-Core) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33487-05171 | Genome Polyprotein (HCV-Core) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33487-05151 | Genome Polyprotein (HCV-Core) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 34007-05111 | Gliadin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 34007-05121 | Gliadin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11091-05011 | Goby Urotensin-2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11091-05021 | Goby Urotensin-2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32050-05111 | Hepatitis C Virus E2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32050-05121 | Hepatitis C Virus E2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32050-05161 | Hepatitis C Virus E2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32050-05141 | Hepatitis C Virus E2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32050-05171 | Hepatitis C Virus E2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32050-05151 | Hepatitis C Virus E2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33152-05111 | Hepatitis C Virus Genotype 3 NS3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33152-05121 | Hepatitis C Virus Genotype 3 NS3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33152-05161 | Hepatitis C Virus Genotype 3 NS3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33152-05141 | Hepatitis C Virus Genotype 3 NS3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33152-05171 | Hepatitis C Virus Genotype 3 NS3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33152-05151 | Hepatitis C Virus Genotype 3 NS3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30049-05111 | Histidyl-tRNA Synthetase (HARS) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30049-05121 | Histidyl-tRNA Synthetase (HARS) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30049-05161 | Histidyl-tRNA Synthetase (HARS) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30049-05141 | Histidyl-tRNA Synthetase (HARS) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30049-05171 | Histidyl-tRNA Synthetase (HARS) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30049-05151 | Histidyl-tRNA Synthetase (HARS) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30200-05111 | Histone Complex (H1, H2A, H2B, H3, H4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30200-05121 | Histone Complex (H1, H2A, H2B, H3, H4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30200-05161 | Histone Complex (H1, H2A, H2B, H3, H4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30200-05141 | Histone Complex (H1, H2A, H2B, H3, H4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30200-05171 | Histone Complex (H1, H2A, H2B, H3, H4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30200-05151 | Histone Complex (H1, H2A, H2B, H3, H4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30198-05111 | Histone Core Complex (H2A, H2B, H3, H4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30198-05121 | Histone Core Complex (H2A, H2B, H3, H4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30198-05161 | Histone Core Complex (H2A, H2B, H3, H4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30198-05141 | Histone Core Complex (H2A, H2B, H3, H4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30198-05171 | Histone Core Complex (H2A, H2B, H3, H4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30198-05151 | Histone Core Complex (H2A, H2B, H3, H4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32823-05111 | Human 14-3-3 sigma Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32823-05121 | Human 14-3-3 sigma Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32823-05161 | Human 14-3-3 sigma AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32823-05141 | Human 14-3-3 sigma AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32823-05171 | Human 14-3-3 sigma AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32823-05151 | Human 14-3-3 sigma AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36158-05111 | Human 26S Proteasome Subunit S5B (PSMD5) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36158-05121 | Human 26S Proteasome Subunit S5B (PSMD5) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36158-05161 | Human 26S Proteasome Subunit S5B (PSMD5) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36158-05141 | Human 26S Proteasome Subunit S5B (PSMD5) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36158-05171 | Human 26S Proteasome Subunit S5B (PSMD5) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36158-05151 | Human 26S Proteasome Subunit S5B (PSMD5) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35722-05111 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35722-05121 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35722-05161 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35722-05141 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35722-05171 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35722-05151 | Human 3-Hydroxyacyl-CoA Dehydrogenase Type-2 (HSD17B10) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35734-05111 | Human 3-Ketodihydrosphingosine Reductase (KDSR) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35734-05121 | Human 3-Ketodihydrosphingosine Reductase (KDSR) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35734-05161 | Human 3-Ketodihydrosphingosine Reductase (KDSR) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35734-05141 | Human 3-Ketodihydrosphingosine Reductase (KDSR) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35734-05171 | Human 3-Ketodihydrosphingosine Reductase (KDSR) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35734-05151 | Human 3-Ketodihydrosphingosine Reductase (KDSR) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32660-05111 | Human 4-1BB Ligand Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32660-05121 | Human 4-1BB Ligand Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32660-05161 | Human 4-1BB Ligand AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32660-05141 | Human 4-1BB Ligand AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32660-05171 | Human 4-1BB Ligand AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32660-05151 | Human 4-1BB Ligand AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32822-05111 | Human 4E-BP1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32822-05121 | Human 4E-BP1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32822-05161 | Human 4E-BP1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32822-05141 | Human 4E-BP1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32822-05171 | Human 4E-BP1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32822-05151 | Human 4E-BP1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33077-05111 | Human ACAA1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33077-05121 | Human ACAA1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33077-05161 | Human ACAA1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33077-05141 | Human ACAA1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33077-05171 | Human ACAA1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33077-05151 | Human ACAA1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33059-05111 | Human ACAD8 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33059-05121 | Human ACAD8 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33059-05161 | Human ACAD8 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33059-05141 | Human ACAD8 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33059-05171 | Human ACAD8 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33059-05151 | Human ACAD8 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33451-05111 | Human ACAT1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33451-05121 | Human ACAT1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33451-05161 | Human ACAT1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33451-05141 | Human ACAT1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33451-05171 | Human ACAT1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33451-05151 | Human ACAT1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33003-05111 | Human ACAT2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33003-05121 | Human ACAT2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33003-05161 | Human ACAT2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33003-05141 | Human ACAT2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33003-05171 | Human ACAT2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33003-05151 | Human ACAT2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30131-05111 | Human Acid Phosphatase 1 (ACP1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30131-05121 | Human Acid Phosphatase 1 (ACP1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30131-05161 | Human Acid Phosphatase 1 (ACP1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30131-05141 | Human Acid Phosphatase 1 (ACP1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30131-05171 | Human Acid Phosphatase 1 (ACP1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30131-05151 | Human Acid Phosphatase 1 (ACP1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32602-05111 | Human ACP2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32602-05121 | Human ACP2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32602-05161 | Human ACP2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32602-05141 | Human ACP2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32602-05171 | Human ACP2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32602-05151 | Human ACP2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32665-05111 | Human ACP6 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32665-05121 | Human ACP6 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32665-05161 | Human ACP6 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32665-05141 | Human ACP6 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32665-05171 | Human ACP6 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32665-05151 | Human ACP6 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33518-05111 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33518-05121 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33518-05161 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33518-05141 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33518-05171 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33518-05151 | Human Acyl-CoA Synthetase Family Member 2 (ACSF2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35694-05111 | Human Acyl-CoA Thioesterase 11 (ACOT11) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35694-05121 | Human Acyl-CoA Thioesterase 11 (ACOT11) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35694-05161 | Human Acyl-CoA Thioesterase 11 (ACOT11) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35694-05141 | Human Acyl-CoA Thioesterase 11 (ACOT11) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35694-05171 | Human Acyl-CoA Thioesterase 11 (ACOT11) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35694-05151 | Human Acyl-CoA Thioesterase 11 (ACOT11) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36518-05111 | Human Acyl-CoA Thioesterase 7 (ACOT7) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36518-05121 | Human Acyl-CoA Thioesterase 7 (ACOT7) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36518-05161 | Human Acyl-CoA Thioesterase 7 (ACOT7) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36518-05141 | Human Acyl-CoA Thioesterase 7 (ACOT7) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36518-05171 | Human Acyl-CoA Thioesterase 7 (ACOT7) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36518-05151 | Human Acyl-CoA Thioesterase 7 (ACOT7) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33392-05111 | Human Acyl-coenzyme A Thioesterase 8 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33392-05121 | Human Acyl-coenzyme A Thioesterase 8 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33392-05161 | Human Acyl-coenzyme A Thioesterase 8 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33392-05141 | Human Acyl-coenzyme A Thioesterase 8 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33392-05171 | Human Acyl-coenzyme A Thioesterase 8 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33392-05151 | Human Acyl-coenzyme A Thioesterase 8 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32206-05111 | Human Acylphosphatase-1 (ACYP1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32206-05121 | Human Acylphosphatase-1 (ACYP1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32206-05161 | Human Acylphosphatase-1 (ACYP1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32206-05141 | Human Acylphosphatase-1 (ACYP1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32206-05171 | Human Acylphosphatase-1 (ACYP1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32206-05151 | Human Acylphosphatase-1 (ACYP1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32776-05111 | Human ADAL Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32776-05121 | Human ADAL Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32776-05161 | Human ADAL AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32776-05141 | Human ADAL AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32776-05171 | Human ADAL AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32776-05151 | Human ADAL AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16951-05111 | Human ADAMTS13 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 16951-05121 | Human ADAMTS13 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 16951-05161 | Human ADAMTS13 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16951-05141 | Human ADAMTS13 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 16951-05171 | Human ADAMTS13 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16951-05151 | Human ADAMTS13 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35692-05111 | Human Adenine Phosphoribosyltransferase (APRT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35692-05121 | Human Adenine Phosphoribosyltransferase (APRT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35692-05161 | Human Adenine Phosphoribosyltransferase (APRT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35692-05141 | Human Adenine Phosphoribosyltransferase (APRT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35692-05171 | Human Adenine Phosphoribosyltransferase (APRT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35692-05151 | Human Adenine Phosphoribosyltransferase (APRT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35689-05111 | Human Adenosylhomocysteinase (AHCY) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35689-05121 | Human Adenosylhomocysteinase (AHCY) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35689-05161 | Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35689-05141 | Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35689-05171 | Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35689-05151 | Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32180-05111 | Human Adenylate Kinase 2 (AK 2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32180-05121 | Human Adenylate Kinase 2 (AK 2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32180-05161 | Human Adenylate Kinase 2 (AK 2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32180-05141 | Human Adenylate Kinase 2 (AK 2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32180-05171 | Human Adenylate Kinase 2 (AK 2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32180-05151 | Human Adenylate Kinase 2 (AK 2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30030-05111 | Human Adenylate Kinase 3 (AK 3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30030-05121 | Human Adenylate Kinase 3 (AK 3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30030-05161 | Human Adenylate Kinase 3 (AK 3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30030-05141 | Human Adenylate Kinase 3 (AK 3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30030-05171 | Human Adenylate Kinase 3 (AK 3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30030-05151 | Human Adenylate Kinase 3 (AK 3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33097-05111 | Human Adenylate Kinase 4 (AK4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33097-05121 | Human Adenylate Kinase 4 (AK4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33097-05161 | Human Adenylate Kinase 4 (AK4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33097-05141 | Human Adenylate Kinase 4 (AK4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33097-05171 | Human Adenylate Kinase 4 (AK4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33097-05151 | Human Adenylate Kinase 4 (AK4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32028-05111 | Human Adenylate Kinase Isoenzyme 1 (AK 1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32028-05121 | Human Adenylate Kinase Isoenzyme 1 (AK 1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32028-05161 | Human Adenylate Kinase Isoenzyme 1 (AK 1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32028-05141 | Human Adenylate Kinase Isoenzyme 1 (AK 1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32028-05171 | Human Adenylate Kinase Isoenzyme 1 (AK 1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32028-05151 | Human Adenylate Kinase Isoenzyme 1 (AK 1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32287-05111 | Human Adenylosuccinate Lyase (ADSL) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32287-05121 | Human Adenylosuccinate Lyase (ADSL) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32287-05161 | Human Adenylosuccinate Lyase (ADSL) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32287-05141 | Human Adenylosuccinate Lyase (ADSL) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32287-05171 | Human Adenylosuccinate Lyase (ADSL) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32287-05151 | Human Adenylosuccinate Lyase (ADSL) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32732-05111 | Human ADI1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32732-05121 | Human ADI1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32732-05161 | Human ADI1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32732-05141 | Human ADI1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32732-05171 | Human ADI1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32732-05151 | Human ADI1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10361-05011 | Human Adiponectin (ACRP30) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11741-05011 | Human Adiponectin (ACRP30) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11742-05011 | Human Adiponectin (ACRP30) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11743-05011 | Human Adiponectin (ACRP30) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32105-05111 | Human Adiponectin (ACRP30) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10361-05021 | Human Adiponectin (ACRP30) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11741-05021 | Human Adiponectin (ACRP30) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11742-05021 | Human Adiponectin (ACRP30) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11743-05021 | Human Adiponectin (ACRP30) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32105-05121 | Human Adiponectin (ACRP30) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10361-05061 | Human Adiponectin (ACRP30) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32105-05161 | Human Adiponectin (ACRP30) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10361-05041 | Human Adiponectin (ACRP30) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32105-05141 | Human Adiponectin (ACRP30) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 10361-05071 | Human Adiponectin (ACRP30) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32105-05171 | Human Adiponectin (ACRP30) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10361-05051 | Human Adiponectin (ACRP30) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32105-05151 | Human Adiponectin (ACRP30) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33145-05111 | Human ADK Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33145-05121 | Human ADK Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33145-05161 | Human ADK AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33145-05141 | Human ADK AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33145-05171 | Human ADK AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33145-05151 | Human ADK AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30248-05111 | Human ADP-ribosylation Factor 1 (ARF1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30248-05121 | Human ADP-ribosylation Factor 1 (ARF1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30248-05161 | Human ADP-ribosylation Factor 1 (ARF1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30248-05141 | Human ADP-ribosylation Factor 1 (ARF1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30248-05171 | Human ADP-ribosylation Factor 1 (ARF1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30248-05151 | Human ADP-ribosylation Factor 1 (ARF1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32272-05111 | Human ADP-ribosylation Factor 3 (ARF3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32272-05121 | Human ADP-ribosylation Factor 3 (ARF3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32272-05161 | Human ADP-ribosylation Factor 3 (ARF3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32272-05141 | Human ADP-ribosylation Factor 3 (ARF3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32272-05171 | Human ADP-ribosylation Factor 3 (ARF3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32272-05151 | Human ADP-ribosylation Factor 3 (ARF3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33016-05111 | Human ADP-ribosylation Factor 6 (ARF6) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33016-05121 | Human ADP-ribosylation Factor 6 (ARF6) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33016-05161 | Human ADP-ribosylation Factor 6 (ARF6) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33016-05141 | Human ADP-ribosylation Factor 6 (ARF6) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33016-05171 | Human ADP-ribosylation Factor 6 (ARF6) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33016-05151 | Human ADP-ribosylation Factor 6 (ARF6) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30173-05111 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30173-05121 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30173-05161 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30173-05141 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30173-05171 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30173-05151 | Human ADP-ribosylation Factor-like Protein 1 (ARL1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32115-05111 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32115-05121 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32115-05161 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32115-05141 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32115-05171 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32115-05151 | Human ADP-ribosylation Factor-like Protein 2 (ARL2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30177-05111 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30177-05121 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30177-05161 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30177-05141 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30177-05171 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30177-05151 | Human ADP-ribosylation Factor-like Protein 2-Binding Protein (ARL2BP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32900-05111 | Human ADPRH Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32900-05121 | Human ADPRH Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32900-05161 | Human ADPRH AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32900-05141 | Human ADPRH AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32900-05171 | Human ADPRH AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32900-05151 | Human ADPRH AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10371-05011 | Human Adrenomedullin (AM) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10371-05021 | Human Adrenomedullin (AM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33087-05111 | Human AGR3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33087-05121 | Human AGR3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33087-05161 | Human AGR3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33087-05141 | Human AGR3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33087-05171 | Human AGR3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33087-05151 | Human AGR3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32922-05111 | Human AHA1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32922-05121 | Human AHA1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32922-05161 | Human AHA1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32922-05141 | Human AHA1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32922-05171 | Human AHA1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32922-05151 | Human AHA1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32607-05111 | Human AHSP Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32607-05121 | Human AHSP Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32607-05161 | Human AHSP AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32607-05141 | Human AHSP AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32607-05171 | Human AHSP AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32607-05151 | Human AHSP AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33042-05111 | Human AIMP3/p18 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33042-05121 | Human AIMP3/p18 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33042-05161 | Human AIMP3/p18 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33042-05141 | Human AIMP3/p18 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33042-05171 | Human AIMP3/p18 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33042-05151 | Human AIMP3/p18 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32633-05111 | Human AKR1B10 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32633-05121 | Human AKR1B10 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32633-05161 | Human AKR1B10 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32633-05141 | Human AKR1B10 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32633-05171 | Human AKR1B10 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32633-05151 | Human AKR1B10 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33162-05111 | Human AKR1C1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33162-05121 | Human AKR1C1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33162-05161 | Human AKR1C1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33162-05141 | Human AKR1C1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33162-05171 | Human AKR1C1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33162-05151 | Human AKR1C1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32625-05111 | Human AKR1C3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32625-05121 | Human AKR1C3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32625-05161 | Human AKR1C3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32625-05141 | Human AKR1C3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32625-05171 | Human AKR1C3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32625-05151 | Human AKR1C3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33210-05111 | Human AKR1C4 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33210-05121 | Human AKR1C4 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33210-05161 | Human AKR1C4 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33210-05141 | Human AKR1C4 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33210-05171 | Human AKR1C4 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33210-05151 | Human AKR1C4 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32569-05111 | Human AKT1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32569-05121 | Human AKT1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32569-05161 | Human AKT1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32569-05141 | Human AKT1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32569-05171 | Human AKT1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32569-05151 | Human AKT1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32925-05111 | Human Alanine Aminotransferase (ALT, GPT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32941-05111 | Human Alanine Aminotransferase (ALT, GPT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32925-05121 | Human Alanine Aminotransferase (ALT, GPT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32941-05121 | Human Alanine Aminotransferase (ALT, GPT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32925-05161 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32941-05161 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32925-05141 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32941-05141 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32925-05171 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32941-05171 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32925-05151 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32941-05151 | Human Alanine Aminotransferase (ALT, GPT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12001-05011 | Human Albumin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12001-05021 | Human Albumin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12001-05061 | Human Albumin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12001-05041 | Human Albumin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12001-05071 | Human Albumin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12001-05051 | Human Albumin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32007-05111 | Human Alcohol Dehydrogenase (AKR1A1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32007-05121 | Human Alcohol Dehydrogenase (AKR1A1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32007-05161 | Human Alcohol Dehydrogenase (AKR1A1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32007-05141 | Human Alcohol Dehydrogenase (AKR1A1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32007-05171 | Human Alcohol Dehydrogenase (AKR1A1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32007-05151 | Human Alcohol Dehydrogenase (AKR1A1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32753-05111 | Human Alcohol Dehydrogenase 1A (ADH1A) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32753-05121 | Human Alcohol Dehydrogenase 1A (ADH1A) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32753-05161 | Human Alcohol Dehydrogenase 1A (ADH1A) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32753-05141 | Human Alcohol Dehydrogenase 1A (ADH1A) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32753-05171 | Human Alcohol Dehydrogenase 1A (ADH1A) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32753-05151 | Human Alcohol Dehydrogenase 1A (ADH1A) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32746-05111 | Human Alcohol Dehydrogenase 1C (ADH1C) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32746-05121 | Human Alcohol Dehydrogenase 1C (ADH1C) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32746-05161 | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32746-05141 | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32746-05171 | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32746-05151 | Human Alcohol Dehydrogenase 1C (ADH1C) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32262-05111 | Human Alcohol Dehydrogenase 6 (ADH6) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32262-05121 | Human Alcohol Dehydrogenase 6 (ADH6) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32262-05161 | Human Alcohol Dehydrogenase 6 (ADH6) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32262-05141 | Human Alcohol Dehydrogenase 6 (ADH6) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32262-05171 | Human Alcohol Dehydrogenase 6 (ADH6) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32262-05151 | Human Alcohol Dehydrogenase 6 (ADH6) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32005-05111 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32005-05121 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32005-05161 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32005-05141 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32005-05171 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32005-05151 | Human Aldehyde Dehydrogenase 1A1 (ALDH1A1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32705-05111 | Human ALDH2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32705-05121 | Human ALDH2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32705-05161 | Human ALDH2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32705-05141 | Human ALDH2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32705-05171 | Human ALDH2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32705-05151 | Human ALDH2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32564-05111 | Human Aldolase A Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32564-05121 | Human Aldolase A Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32564-05161 | Human Aldolase A AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32564-05141 | Human Aldolase A AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32564-05171 | Human Aldolase A AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32564-05151 | Human Aldolase A AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33331-05111 | Human Aldolase B Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33331-05121 | Human Aldolase B Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33331-05161 | Human Aldolase B AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33331-05141 | Human Aldolase B AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33331-05171 | Human Aldolase B AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33331-05151 | Human Aldolase B AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32088-05111 | Human Aldolase C Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32088-05121 | Human Aldolase C Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32088-05161 | Human Aldolase C AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32088-05141 | Human Aldolase C AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32088-05171 | Human Aldolase C AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32088-05151 | Human Aldolase C AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31289-05111 | Human Aldose Reductase (AR) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31289-05121 | Human Aldose Reductase (AR) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31289-05161 | Human Aldose Reductase (AR) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31289-05141 | Human Aldose Reductase (AR) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31289-05171 | Human Aldose Reductase (AR) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31289-05151 | Human Aldose Reductase (AR) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33012-05111 | Human ALIX Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33012-05121 | Human ALIX Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33012-05161 | Human ALIX AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33012-05141 | Human ALIX AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33012-05171 | Human ALIX AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33012-05151 | Human ALIX AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32918-05111 | Human Alkaline Phosphatase (ALP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32928-05111 | Human Alkaline Phosphatase (ALP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32918-05121 | Human Alkaline Phosphatase (ALP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32928-05121 | Human Alkaline Phosphatase (ALP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32918-05161 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32928-05161 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32918-05141 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32928-05141 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32918-05171 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32928-05171 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32918-05151 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32928-05151 | Human Alkaline Phosphatase (ALP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33202-05111 | Human ALKBH2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33202-05121 | Human ALKBH2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33202-05161 | Human ALKBH2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33202-05141 | Human ALKBH2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33202-05171 | Human ALKBH2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33202-05151 | Human ALKBH2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32860-05111 | Human alpha A Crystallin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32860-05121 | Human alpha A Crystallin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32860-05161 | Human alpha A Crystallin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32860-05141 | Human alpha A Crystallin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32860-05171 | Human alpha A Crystallin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32860-05151 | Human alpha A Crystallin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16931-05011 | Human alpha Amylase Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 16931-05021 | Human alpha Amylase Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 16931-05061 | Human alpha Amylase AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16931-05041 | Human alpha Amylase AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 16931-05071 | Human alpha Amylase AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 16931-05051 | Human alpha Amylase AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32856-05111 | Human alpha B Crystallin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32856-05121 | Human alpha B Crystallin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32856-05161 | Human alpha B Crystallin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32856-05141 | Human alpha B Crystallin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32856-05171 | Human alpha B Crystallin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32856-05151 | Human alpha B Crystallin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32109-05111 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32109-05121 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32109-05161 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32109-05141 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32109-05171 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32109-05151 | Human alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12011-05011 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32220-05111 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12011-05021 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32220-05121 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12011-05061 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32220-05161 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12011-05041 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32220-05141 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12011-05071 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32220-05171 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12011-05051 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32220-05151 | Human alpha-1-Acid-Glycoprotein (Orosomucoid, AGP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11131-05011 | Human alpha-1-Antichymotrypsin (AACT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31101-05111 | Human alpha-1-Antichymotrypsin (AACT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11131-05021 | Human alpha-1-Antichymotrypsin (AACT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31101-05121 | Human alpha-1-Antichymotrypsin (AACT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11131-05061 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31101-05161 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11131-05041 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31101-05141 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11131-05071 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31101-05171 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11131-05051 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31101-05151 | Human alpha-1-Antichymotrypsin (AACT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11141-05011 | Human alpha-1-Antitripsin (A1AT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11141-05021 | Human alpha-1-Antitripsin (A1AT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11141-05061 | Human alpha-1-Antitripsin (A1AT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11141-05041 | Human alpha-1-Antitripsin (A1AT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11141-05071 | Human alpha-1-Antitripsin (A1AT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11141-05051 | Human alpha-1-Antitripsin (A1AT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32603-05111 | Human alpha-1-Antitrypsin (A1AT) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32603-05121 | Human alpha-1-Antitrypsin (A1AT) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32603-05161 | Human alpha-1-Antitrypsin (A1AT) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32603-05141 | Human alpha-1-Antitrypsin (A1AT) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32603-05171 | Human alpha-1-Antitrypsin (A1AT) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32603-05151 | Human alpha-1-Antitrypsin (A1AT) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12051-05011 | Human alpha-1-Microglobulin (A1M) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12051-05021 | Human alpha-1-Microglobulin (A1M) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12051-05061 | Human alpha-1-Microglobulin (A1M) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12051-05041 | Human alpha-1-Microglobulin (A1M) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12051-05071 | Human alpha-1-Microglobulin (A1M) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12051-05051 | Human alpha-1-Microglobulin (A1M) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 13081-05011 | Human alpha-2-Antiplasmin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 13081-05021 | Human alpha-2-Antiplasmin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 13081-05061 | Human alpha-2-Antiplasmin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 13081-05041 | Human alpha-2-Antiplasmin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 13081-05071 | Human alpha-2-Antiplasmin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 13081-05051 | Human alpha-2-Antiplasmin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11441-05011 | Human alpha-2-Macroglobulin (A2M) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11441-05021 | Human alpha-2-Macroglobulin (A2M) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11441-05061 | Human alpha-2-Macroglobulin (A2M) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11441-05041 | Human alpha-2-Macroglobulin (A2M) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11441-05071 | Human alpha-2-Macroglobulin (A2M) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11441-05051 | Human alpha-2-Macroglobulin (A2M) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33334-05111 | Human Alpha-2-macroglobulin Receptor-associated Protein Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33334-05121 | Human Alpha-2-macroglobulin Receptor-associated Protein Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33334-05161 | Human Alpha-2-macroglobulin Receptor-associated Protein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33334-05141 | Human Alpha-2-macroglobulin Receptor-associated Protein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33334-05171 | Human Alpha-2-macroglobulin Receptor-associated Protein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33334-05151 | Human Alpha-2-macroglobulin Receptor-associated Protein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33287-05111 | Human alpha-Actinin-1 (ACTN1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33287-05121 | Human alpha-Actinin-1 (ACTN1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33287-05161 | Human alpha-Actinin-1 (ACTN1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33287-05141 | Human alpha-Actinin-1 (ACTN1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33287-05171 | Human alpha-Actinin-1 (ACTN1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33287-05151 | Human alpha-Actinin-1 (ACTN1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32015-05111 | Human alpha-Endosulfine (ENSA) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32015-05121 | Human alpha-Endosulfine (ENSA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32015-05161 | Human alpha-Endosulfine (ENSA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32015-05141 | Human alpha-Endosulfine (ENSA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32015-05171 | Human alpha-Endosulfine (ENSA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32015-05151 | Human alpha-Endosulfine (ENSA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12021-05011 | Human alpha-Fetoprotein (AFP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32221-05111 | Human alpha-Fetoprotein (AFP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12021-05021 | Human alpha-Fetoprotein (AFP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32221-05121 | Human alpha-Fetoprotein (AFP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12021-05061 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32221-05161 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12021-05041 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32221-05141 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12021-05071 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32221-05171 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12021-05051 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32221-05151 | Human alpha-Fetoprotein (AFP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30130-05111 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30130-05121 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30130-05161 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30130-05141 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30130-05171 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30130-05151 | Human alpha-Ketoglutarate-dependent Dioxygenase alkB Homolog 3 (ALKBH3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12061-05011 | Human alpha-Synuclein Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32879-05111 | Human alpha-Synuclein antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32911-05111 | Human alpha-Synuclein Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32933-05111 | Human alpha-Synuclein Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12061-05021 | Human alpha-Synuclein Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32879-05121 | Human alpha-Synuclein antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32911-05121 | Human alpha-Synuclein Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32933-05121 | Human alpha-Synuclein Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12061-05061 | Human alpha-Synuclein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32879-05161 | Human alpha-Synuclein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32911-05161 | Human alpha-Synuclein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32933-05161 | Human alpha-Synuclein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12061-05041 | Human alpha-Synuclein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32879-05141 | Human alpha-Synuclein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32911-05141 | Human alpha-Synuclein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32933-05141 | Human alpha-Synuclein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12061-05071 | Human alpha-Synuclein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32879-05171 | Human alpha-Synuclein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32911-05171 | Human alpha-Synuclein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32933-05171 | Human alpha-Synuclein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12061-05051 | Human alpha-Synuclein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32879-05151 | Human alpha-Synuclein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32911-05151 | Human alpha-Synuclein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32933-05151 | Human alpha-Synuclein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11571-05011 | Human alpha-Thrombin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 41571-05111 | Human alpha-Thrombin Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 11571-05021 | Human alpha-Thrombin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 41571-05121 | Human alpha-Thrombin Antibody (Biotin Conjugate) | IgY-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11571-05061 | Human alpha-Thrombin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11571-05041 | Human alpha-Thrombin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 41571-05141 | Human alpha-Thrombin AssayLite Antibody (FITC Conjugate) | IgY-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11571-05071 | Human alpha-Thrombin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11571-05051 | Human alpha-Thrombin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32907-05111 | Human Amelotin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32907-05121 | Human Amelotin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32907-05161 | Human Amelotin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32907-05141 | Human Amelotin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32907-05171 | Human Amelotin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32907-05151 | Human Amelotin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35627-05111 | Human Amisyn Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35627-05121 | Human Amisyn Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35627-05161 | Human Amisyn AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35627-05141 | Human Amisyn AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35627-05171 | Human Amisyn AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35627-05151 | Human Amisyn AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11661-05011 | Human Amminoterminal Fragment Urokinase [ATF-Urokinase (uPA)] Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11661-05021 | Human Amminoterminal Fragment Urokinase [ATF-Urokinase (uPA)] Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33435-05111 | Human AMPK beta 2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33435-05121 | Human AMPK beta 2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33435-05161 | Human AMPK beta 2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33435-05141 | Human AMPK beta 2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33435-05171 | Human AMPK beta 2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33435-05151 | Human AMPK beta 2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32535-05111 | Human AMT Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32535-05121 | Human AMT Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32535-05161 | Human AMT AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32535-05141 | Human AMT AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32535-05171 | Human AMT AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32535-05151 | Human AMT AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33302-05111 | Human AMY-1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33302-05121 | Human AMY-1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33302-05161 | Human AMY-1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33302-05141 | Human AMY-1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33302-05171 | Human AMY-1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33302-05151 | Human AMY-1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11751-05011 | Human Amylin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11751-05021 | Human Amylin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33124-05111 | Human Amyloid Precursor Protein (APP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33124-05121 | Human Amyloid Precursor Protein (APP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33124-05161 | Human Amyloid Precursor Protein (APP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33124-05141 | Human Amyloid Precursor Protein (APP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33124-05171 | Human Amyloid Precursor Protein (APP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33124-05151 | Human Amyloid Precursor Protein (APP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31388-05111 | Human Angiogenin (ANG) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31388-05121 | Human Angiogenin (ANG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31388-05161 | Human Angiogenin (ANG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31388-05141 | Human Angiogenin (ANG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31388-05171 | Human Angiogenin (ANG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31388-05151 | Human Angiogenin (ANG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32215-05111 | Human Angiopoietin-1 (ANG-1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32215-05121 | Human Angiopoietin-1 (ANG-1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32215-05161 | Human Angiopoietin-1 (ANG-1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32215-05141 | Human Angiopoietin-1 (ANG-1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32215-05171 | Human Angiopoietin-1 (ANG-1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32215-05151 | Human Angiopoietin-1 (ANG-1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33505-05111 | Human Angiostatin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33505-05121 | Human Angiostatin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33505-05161 | Human Angiostatin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33505-05141 | Human Angiostatin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33505-05171 | Human Angiostatin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33505-05151 | Human Angiostatin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10441-05011 | Human Angiotensin I Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10441-05021 | Human Angiotensin I Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 10461-05011 | Human Angiotensin III Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10461-05021 | Human Angiotensin III Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11013-05011 | Human Angiotensinogen Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36822-05111 | Human Angiotensinogen Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11013-05021 | Human Angiotensinogen Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36822-05121 | Human Angiotensinogen Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36822-05161 | Human Angiotensinogen Antibody AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36822-05141 | Human Angiotensinogen Antibody AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36822-05171 | Human Angiotensinogen Antibody AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36822-05151 | Human Angiotensinogen Antibody AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32171-05111 | Human Annexin A1 (ANXA1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32171-05121 | Human Annexin A1 (ANXA1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32171-05161 | Human Annexin A1 (ANXA1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32171-05141 | Human Annexin A1 (ANXA1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32171-05171 | Human Annexin A1 (ANXA1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32171-05151 | Human Annexin A1 (ANXA1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33151-05111 | Human Annexin A10 (ANXA10) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33151-05121 | Human Annexin A10 (ANXA10) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33151-05161 | Human Annexin A10 (ANXA10) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33151-05141 | Human Annexin A10 (ANXA10) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33151-05171 | Human Annexin A10 (ANXA10) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33151-05151 | Human Annexin A10 (ANXA10) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32036-05111 | Human Annexin A11 (ANXA11) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32036-05121 | Human Annexin A11 (ANXA11) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32036-05161 | Human Annexin A11 (ANXA11) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32036-05141 | Human Annexin A11 (ANXA11) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32036-05171 | Human Annexin A11 (ANXA11) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32036-05151 | Human Annexin A11 (ANXA11) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30219-05111 | Human Annexin A13 (ANXA13) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30219-05121 | Human Annexin A13 (ANXA13) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30219-05161 | Human Annexin A13 (ANXA13) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30219-05141 | Human Annexin A13 (ANXA13) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30219-05171 | Human Annexin A13 (ANXA13) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30219-05151 | Human Annexin A13 (ANXA13) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33118-05111 | Human Annexin A3 (ANXA3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33118-05121 | Human Annexin A3 (ANXA3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33118-05161 | Human Annexin A3 (ANXA3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33118-05141 | Human Annexin A3 (ANXA3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33118-05171 | Human Annexin A3 (ANXA3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33118-05151 | Human Annexin A3 (ANXA3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30112-05111 | Human Annexin A4 (ANXA4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30112-05121 | Human Annexin A4 (ANXA4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30112-05161 | Human Annexin A4 (ANXA4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30112-05141 | Human Annexin A4 (ANXA4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30112-05171 | Human Annexin A4 (ANXA4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30112-05151 | Human Annexin A4 (ANXA4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30241-05111 | Human Annexin A5 (ANXA5) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30241-05121 | Human Annexin A5 (ANXA5) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30241-05161 | Human Annexin A5 (ANXA5) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30241-05141 | Human Annexin A5 (ANXA5) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30241-05171 | Human Annexin A5 (ANXA5) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30241-05151 | Human Annexin A5 (ANXA5) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32060-05111 | Human Annexin A7 (ANXA7) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32060-05121 | Human Annexin A7 (ANXA7) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32060-05161 | Human Annexin A7 (ANXA7) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32060-05141 | Human Annexin A7 (ANXA7) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32060-05171 | Human Annexin A7 (ANXA7) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32060-05151 | Human Annexin A7 (ANXA7) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32024-05111 | Human Annexin A8 (ANXA8) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32024-05121 | Human Annexin A8 (ANXA8) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32024-05161 | Human Annexin A8 (ANXA8) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32024-05141 | Human Annexin A8 (ANXA8) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32024-05171 | Human Annexin A8 (ANXA8) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32024-05151 | Human Annexin A8 (ANXA8) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32924-05111 | Human Antistreptolysin O (ASO) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32924-05121 | Human Antistreptolysin O (ASO) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32924-05161 | Human Antistreptolysin O (ASO) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32924-05141 | Human Antistreptolysin O (ASO) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32924-05171 | Human Antistreptolysin O (ASO) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32924-05151 | Human Antistreptolysin O (ASO) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12161-05011 | Human Antithrombin III (AT3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32063-05111 | Human Antithrombin III (AT3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 41351-05111 | Human Antithrombin III (AT3) Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 12161-05021 | Human Antithrombin III (AT3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32063-05121 | Human Antithrombin III (AT3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 41351-05121 | Human Antithrombin III (AT3) Antibody (Biotin Conjugate) | IgY-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12161-05061 | Human Antithrombin III (AT3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32063-05161 | Human Antithrombin III (AT3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12161-05041 | Human Antithrombin III (AT3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32063-05141 | Human Antithrombin III (AT3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 41351-05141 | Human Antithrombin III (AT3) AssayLite Antibody (FITC Conjugate) | IgY-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12161-05071 | Human Antithrombin III (AT3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32063-05171 | Human Antithrombin III (AT3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12161-05051 | Human Antithrombin III (AT3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32063-05151 | Human Antithrombin III (AT3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33434-05111 | Human AP3S1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33434-05121 | Human AP3S1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33434-05161 | Human AP3S1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33434-05141 | Human AP3S1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33434-05171 | Human AP3S1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33434-05151 | Human AP3S1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32597-05111 | Human APMAP Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32597-05121 | Human APMAP Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32597-05141 | Human APMAP AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32597-05161 | Human APMAP AssayLite Antibody (FITC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32597-05171 | Human APMAP AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32597-05151 | Human APMAP AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 14080-05011 | Human Apolactoferrin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 14080-05021 | Human Apolactoferrin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 14080-05061 | Human Apolactoferrin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 14080-05041 | Human Apolactoferrin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 14080-05071 | Human Apolactoferrin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 14080-05051 | Human Apolactoferrin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11151-05011 | Human Apolipoprotein A-I (Apo A1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32615-05111 | Human Apolipoprotein A-I (Apo A1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 41151-05011 | Human Apolipoprotein A-I (Apo A1) Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 11151-05021 | Human Apolipoprotein A-I (Apo A1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32615-05121 | Human Apolipoprotein A-I (Apo A1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 41151-05021 | Human Apolipoprotein A-I (Apo A1) Antibody (Biotin Conjugate) | IgY-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11151-05061 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32615-05161 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11151-05041 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32615-05141 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 41151-05041 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (FITC Conjugate) | IgY-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11151-05071 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32615-05171 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11151-05051 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32615-05151 | Human Apolipoprotein A-I (Apo A1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11161-05011 | Human Apolipoprotein A-II (Apo A2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 41161-05011 | Human Apolipoprotein A-II (Apo A2) Antibody | IgY | 150 ug |
| Polyclonal Primary Abs | 11161-05021 | Human Apolipoprotein A-II (Apo A2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 41161-05021 | Human Apolipoprotein A-II (Apo A2) Antibody (Biotin Conjugate) | IgY-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11161-05061 | Human Apolipoprotein A-II (Apo A2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11161-05041 | Human Apolipoprotein A-II (Apo A2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 41161-05041 | Human Apolipoprotein A-II (Apo A2) AssayLite Antibody (FITC Conjugate) | IgY-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11161-05071 | Human Apolipoprotein A-II (Apo A2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11161-05051 | Human Apolipoprotein A-II (Apo A2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22011-05011 | Human Apolipoprotein A-IV (Apo A4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22011-05021 | Human Apolipoprotein A-IV (Apo A4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32139-05111 | Human Apolipoprotein A-V (Apo A5) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32139-05121 | Human Apolipoprotein A-V (Apo A5) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32139-05161 | Human Apolipoprotein A-V (Apo A5) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32139-05141 | Human Apolipoprotein A-V (Apo A5) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32139-05171 | Human Apolipoprotein A-V (Apo A5) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32139-05151 | Human Apolipoprotein A-V (Apo A5) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20521-05011 | Human Apolipoprotein B (Apo B) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 20521-05021 | Human Apolipoprotein B (Apo B) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 20521-05061 | Human Apolipoprotein B (Apo B) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20521-05041 | Human Apolipoprotein B (Apo B) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 20521-05071 | Human Apolipoprotein B (Apo B) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20521-05051 | Human Apolipoprotein B (Apo B) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20501-05011 | Human Apolipoprotein C-I (Apo C1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32041-05111 | Human Apolipoprotein C-I (Apo C1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 20501-05021 | Human Apolipoprotein C-I (Apo C1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32041-05121 | Human Apolipoprotein C-I (Apo C1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 20501-05061 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32041-05161 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20501-05041 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32041-05141 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 20501-05071 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32041-05171 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20501-05051 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32041-05151 | Human Apolipoprotein C-I (Apo C1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20502-05011 | Human Apolipoprotein C-II (Apo C2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 20502-05021 | Human Apolipoprotein C-II (Apo C2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 20502-05061 | Human Apolipoprotein C-II (Apo C2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20502-05041 | Human Apolipoprotein C-II (Apo C2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 20502-05071 | Human Apolipoprotein C-II (Apo C2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20502-05051 | Human Apolipoprotein C-II (Apo C2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20503-05011 | Human Apolipoprotein C-III (Apo C3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 20503-05021 | Human Apolipoprotein C-III (Apo C3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 20503-05061 | Human Apolipoprotein C-III (Apo C3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20503-05041 | Human Apolipoprotein C-III (Apo C3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 20503-05071 | Human Apolipoprotein C-III (Apo C3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 20503-05051 | Human Apolipoprotein C-III (Apo C3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22210-05011 | Human Apolipoprotein E2 (Apo E2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22210-05021 | Human Apolipoprotein E2 (Apo E2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22210-05061 | Human Apolipoprotein E2 (Apo E2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22210-05041 | Human Apolipoprotein E2 (Apo E2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 22210-05071 | Human Apolipoprotein E2 (Apo E2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22210-05051 | Human Apolipoprotein E2 (Apo E2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22211-05011 | Human Apolipoprotein E3 (Apo E3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22211-05021 | Human Apolipoprotein E3 (Apo E3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22211-05061 | Human Apolipoprotein E3 (Apo E3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22211-05041 | Human Apolipoprotein E3 (Apo E3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 22211-05071 | Human Apolipoprotein E3 (Apo E3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22211-05051 | Human Apolipoprotein E3 (Apo E3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22212-05011 | Human Apolipoprotein E4 (Apo E4) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22212-05021 | Human Apolipoprotein E4 (Apo E4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22212-05061 | Human Apolipoprotein E4 (Apo E4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22212-05041 | Human Apolipoprotein E4 (Apo E4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 22212-05071 | Human Apolipoprotein E4 (Apo E4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22212-05051 | Human Apolipoprotein E4 (Apo E4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22222-05011 | Human Apolipoprotein H (Apo H, B2GP1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32222-05111 | Human Apolipoprotein H (Apo H, B2GP1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22222-05021 | Human Apolipoprotein H (Apo H, B2GP1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32222-05121 | Human Apolipoprotein H (Apo H, B2GP1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 22222-05061 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32222-05161 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22222-05041 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32222-05141 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 22222-05071 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32222-05171 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22222-05051 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32222-05151 | Human Apolipoprotein H (Apo H, B2GP1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32067-05111 | Human Apolipoprotein J Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32067-05121 | Human Apolipoprotein J Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32067-05161 | Human Apolipoprotein J AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32067-05141 | Human Apolipoprotein J AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32067-05171 | Human Apolipoprotein J AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32067-05151 | Human Apolipoprotein J AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 22525-05011 | Human Apolipoprotein M (Apo M) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 22525-05021 | Human Apolipoprotein M (Apo M) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33440-05111 | Human Apoptosis Repressor with CARD Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33440-05121 | Human Apoptosis Repressor with CARD Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33440-05161 | Human Apoptosis Repressor with CARD AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33440-05141 | Human Apoptosis Repressor with CARD AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33440-05171 | Human Apoptosis Repressor with CARD AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33440-05151 | Human Apoptosis Repressor with CARD AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35690-05111 | Human Apoptosis-Inducing Factor 1 (AIF) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35690-05121 | Human Apoptosis-Inducing Factor 1 (AIF) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35690-05161 | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35690-05141 | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35690-05171 | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35690-05151 | Human Apoptosis-Inducing Factor 1 (AIF) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12091-05011 | Human Apotransferrin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12091-05021 | Human Apotransferrin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12091-05061 | Human Apotransferrin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12091-05041 | Human Apotransferrin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12091-05071 | Human Apotransferrin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12091-05051 | Human Apotransferrin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32048-05111 | Human APRIL Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32048-05121 | Human APRIL Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32048-05161 | Human APRIL AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32048-05141 | Human APRIL AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32048-05171 | Human APRIL AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32048-05151 | Human APRIL AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32855-05111 | Human ARA9 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32855-05121 | Human ARA9 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32855-05161 | Human ARA9 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32855-05141 | Human ARA9 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32855-05171 | Human ARA9 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32855-05151 | Human ARA9 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33243-05111 | Human ARF4L Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33243-05121 | Human ARF4L Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33243-05161 | Human ARF4L AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33243-05141 | Human ARF4L AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33243-05171 | Human ARF4L AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33243-05151 | Human ARF4L AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33208-05111 | Human ARF5 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33208-05121 | Human ARF5 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33208-05161 | Human ARF5 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33208-05141 | Human ARF5 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33208-05171 | Human ARF5 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33208-05151 | Human ARF5 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32289-05111 | Human Argininosuccinate Lyase (ASL) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32289-05121 | Human Argininosuccinate Lyase (ASL) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32289-05161 | Human Argininosuccinate Lyase (ASL) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32289-05141 | Human Argininosuccinate Lyase (ASL) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32289-05171 | Human Argininosuccinate Lyase (ASL) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32289-05151 | Human Argininosuccinate Lyase (ASL) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33462-05111 | Human ARH3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33462-05121 | Human ARH3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33462-05161 | Human ARH3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33462-05141 | Human ARH3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33462-05171 | Human ARH3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33462-05151 | Human ARH3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32885-05111 | Human ARL11 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32885-05121 | Human ARL11 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32885-05161 | Human ARL11 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32885-05141 | Human ARL11 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32885-05171 | Human ARL11 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32885-05151 | Human ARL11 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32739-05111 | Human ARL14 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32739-05121 | Human ARL14 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32739-05161 | Human ARL14 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32739-05141 | Human ARL14 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32739-05171 | Human ARL14 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32739-05151 | Human ARL14 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33004-05111 | Human ARL3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33004-05121 | Human ARL3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33004-05161 | Human ARL3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33004-05141 | Human ARL3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33004-05171 | Human ARL3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33004-05151 | Human ARL3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32906-05111 | Human ARL5B Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32906-05121 | Human ARL5B Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32906-05161 | Human ARL5B AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32906-05141 | Human ARL5B AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32906-05171 | Human ARL5B AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32906-05151 | Human ARL5B AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33323-05111 | Human ARMET Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33323-05121 | Human ARMET Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33323-05161 | Human ARMET AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33323-05141 | Human ARMET AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33323-05171 | Human ARMET AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33323-05151 | Human ARMET AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33791-05111 | Human Arylsulfatase A (ASA) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33791-05121 | Human Arylsulfatase A (ASA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33791-05161 | Human Arylsulfatase A (ASA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33791-05141 | Human Arylsulfatase A (ASA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33791-05171 | Human Arylsulfatase A (ASA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33791-05151 | Human Arylsulfatase A (ASA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32248-05111 | Human Arylsulfatase G (ARSG) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32248-05121 | Human Arylsulfatase G (ARSG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32248-05161 | Human Arylsulfatase G (ARSG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32248-05141 | Human Arylsulfatase G (ARSG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32248-05171 | Human Arylsulfatase G (ARSG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32248-05151 | Human Arylsulfatase G (ARSG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32069-05111 | Human ASAM Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32069-05121 | Human ASAM Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32069-05161 | Human ASAM AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32069-05141 | Human ASAM AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32069-05171 | Human ASAM AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32069-05151 | Human ASAM AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33449-05111 | Human ASGR2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33449-05121 | Human ASGR2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33449-05161 | Human ASGR2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33449-05141 | Human ASGR2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33449-05171 | Human ASGR2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33449-05151 | Human ASGR2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31335-05111 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31335-05121 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31335-05161 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31335-05141 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31335-05171 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31335-05151 | Human Aspartate Aminotransferase -Mitochondrial (GOT2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33034-05111 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33034-05121 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33034-05161 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33034-05141 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33034-05171 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33034-05151 | Human Aspartate Aminotransferase, Cytoplasmic (cAspAT, GOT1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32663-05111 | Human Aspartoacylase (ASPA) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32663-05121 | Human Aspartoacylase (ASPA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32663-05161 | Human Aspartoacylase (ASPA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32663-05141 | Human Aspartoacylase (ASPA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32663-05171 | Human Aspartoacylase (ASPA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32663-05151 | Human Aspartoacylase (ASPA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31337-05111 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31337-05121 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31337-05161 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31337-05141 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31337-05171 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31337-05151 | Human Aspartyl-tRNA Synthetase (AspRS, DARS) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32729-05111 | Human ASPRV1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32729-05121 | Human ASPRV1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32729-05161 | Human ASPRV1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32729-05141 | Human ASPRV1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32729-05171 | Human ASPRV1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32729-05151 | Human ASPRV1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32853-05111 | Human ATF3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32853-05121 | Human ATF3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32853-05161 | Human ATF3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32853-05141 | Human ATF3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32853-05171 | Human ATF3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32853-05151 | Human ATF3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32244-05111 | Human ATG10 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32244-05121 | Human ATG10 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32244-05161 | Human ATG10 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32244-05141 | Human ATG10 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32244-05171 | Human ATG10 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32244-05151 | Human ATG10 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32747-05111 | Human ATG4B Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32747-05121 | Human ATG4B Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32747-05161 | Human ATG4B AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32747-05141 | Human ATG4B AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32747-05171 | Human ATG4B AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32747-05151 | Human ATG4B AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32618-05111 | Human ATOX1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32618-05121 | Human ATOX1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32618-05161 | Human ATOX1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32618-05141 | Human ATOX1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32618-05171 | Human ATOX1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32618-05151 | Human ATOX1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32116-05111 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32116-05121 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32116-05161 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32116-05141 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32116-05171 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32116-05151 | Human ATP Synthase Subunit O, Mitochondrial (ATP5O) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32504-05111 | Human ATP6V1F Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32504-05121 | Human ATP6V1F Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32504-05161 | Human ATP6V1F AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32504-05141 | Human ATP6V1F AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32504-05171 | Human ATP6V1F AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32504-05151 | Human ATP6V1F AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33404-05111 | Human ATPase Inhibitory Factor 1/IF1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33404-05121 | Human ATPase Inhibitory Factor 1/IF1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33404-05161 | Human ATPase Inhibitory Factor 1/IF1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33404-05141 | Human ATPase Inhibitory Factor 1/IF1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33404-05171 | Human ATPase Inhibitory Factor 1/IF1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33404-05151 | Human ATPase Inhibitory Factor 1/IF1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10471-05011 | Human Atrial Natriuretic Peptide (ANP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10471-05021 | Human Atrial Natriuretic Peptide (ANP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32656-05111 | Human Aurora A Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32656-05121 | Human Aurora A Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32656-05161 | Human Aurora A AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32656-05141 | Human Aurora A AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32656-05171 | Human Aurora A AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32656-05151 | Human Aurora A AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35693-05111 | Human Aurora Kinase B (AURKB) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 35693-05121 | Human Aurora Kinase B (AURKB) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 35693-05161 | Human Aurora Kinase B (AURKB) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35693-05141 | Human Aurora Kinase B (AURKB) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 35693-05171 | Human Aurora Kinase B (AURKB) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 35693-05151 | Human Aurora Kinase B (AURKB) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32503-05111 | Human AZGP1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32503-05121 | Human AZGP1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32503-05161 | Human AZGP1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32503-05141 | Human AZGP1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32503-05171 | Human AZGP1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32503-05151 | Human AZGP1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12100-05011 | Human Azurocidin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12100-05021 | Human Azurocidin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12100-05051 | Human Azurocidin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12100-05061 | Human Azurocidin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12100-05041 | Human Azurocidin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12100-05071 | Human Azurocidin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33044-05111 | Human BAALC Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33044-05121 | Human BAALC Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33044-05161 | Human BAALC AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33044-05141 | Human BAALC AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33044-05171 | Human BAALC AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33044-05151 | Human BAALC AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32834-05111 | Human BAFF Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32834-05121 | Human BAFF Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32834-05161 | Human BAFF AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32834-05141 | Human BAFF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32834-05171 | Human BAFF AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32834-05151 | Human BAFF AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33167-05111 | Human BAG1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33167-05121 | Human BAG1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33167-05161 | Human BAG1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33167-05141 | Human BAG1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33167-05171 | Human BAG1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33167-05151 | Human BAG1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32647-05111 | Human BAIAP2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32647-05121 | Human BAIAP2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32647-05161 | Human BAIAP2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32647-05141 | Human BAIAP2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32647-05171 | Human BAIAP2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32647-05151 | Human BAIAP2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32089-05111 | Human BATF Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32089-05121 | Human BATF Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32089-05161 | Human BATF AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32089-05141 | Human BATF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32089-05171 | Human BATF AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32089-05151 | Human BATF AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32201-05111 | Human Bcl-2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32201-05121 | Human Bcl-2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32201-05161 | Human Bcl-2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32201-05141 | Human Bcl-2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32201-05171 | Human Bcl-2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32201-05151 | Human Bcl-2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32113-05111 | Human Bcl-2-like Protein 2 (BCL2L2) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32113-05121 | Human Bcl-2-like Protein 2 (BCL2L2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32113-05161 | Human Bcl-2-like Protein 2 (BCL2L2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32113-05141 | Human Bcl-2-like Protein 2 (BCL2L2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32113-05171 | Human Bcl-2-like Protein 2 (BCL2L2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32113-05151 | Human Bcl-2-like Protein 2 (BCL2L2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32225-05111 | Human BCL2L10 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32225-05121 | Human BCL2L10 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32225-05161 | Human BCL2L10 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32225-05141 | Human BCL2L10 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32225-05171 | Human BCL2L10 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32225-05151 | Human BCL2L10 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33402-05111 | Human BCMA Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33402-05121 | Human BCMA Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33402-05161 | Human BCMA AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33402-05141 | Human BCMA AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33402-05171 | Human BCMA AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33402-05151 | Human BCMA AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32038-05111 | Human BDH2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32038-05121 | Human BDH2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32038-05161 | Human BDH2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32038-05141 | Human BDH2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32038-05171 | Human BDH2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32038-05151 | Human BDH2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32507-05111 | Human BDNF Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32507-05121 | Human BDNF Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32507-05161 | Human BDNF AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32507-05141 | Human BDNF AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32507-05171 | Human BDNF AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32507-05151 | Human BDNF AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33007-05111 | Human beta B1 Crystallin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33007-05121 | Human beta B1 Crystallin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33007-05161 | Human beta B1 Crystallin AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33007-05141 | Human beta B1 Crystallin AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33007-05171 | Human beta B1 Crystallin AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33007-05151 | Human beta B1 Crystallin AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32619-05111 | Human beta IG-H3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32619-05121 | Human beta IG-H3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32619-05161 | Human beta IG-H3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32619-05141 | Human beta IG-H3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32619-05171 | Human beta IG-H3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32619-05151 | Human beta IG-H3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32177-05111 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32177-05121 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32177-05161 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32177-05141 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32177-05171 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32177-05151 | Human beta-1,3-glucuronyltransferase 3 (GlcAT-I, B3GAT3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11451-05011 | Human beta-2-Microglobulin (B2M) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 11451-05021 | Human beta-2-Microglobulin (B2M) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 11451-05061 | Human beta-2-Microglobulin (B2M) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11451-05041 | Human beta-2-Microglobulin (B2M) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 11451-05071 | Human beta-2-Microglobulin (B2M) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 11451-05051 | Human beta-2-Microglobulin (B2M) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10601-05011 | Human beta-Casomorphin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10601-05021 | Human beta-Casomorphin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32756-05111 | Human beta-Sarcoglycan (SGCB) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32756-05121 | Human beta-Sarcoglycan (SGCB) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32756-05161 | Human beta-Sarcoglycan (SGCB) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32756-05141 | Human beta-Sarcoglycan (SGCB) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32756-05171 | Human beta-Sarcoglycan (SGCB) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32756-05151 | Human beta-Sarcoglycan (SGCB) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12071-05011 | Human beta-Synuclein Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 12071-05021 | Human beta-Synuclein Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 12071-05061 | Human beta-Synuclein AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12071-05041 | Human beta-Synuclein AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 12071-05071 | Human beta-Synuclein AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 12071-05051 | Human beta-Synuclein AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32870-05111 | Human BHMT Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32870-05121 | Human BHMT Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32870-05161 | Human BHMT AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32870-05141 | Human BHMT AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32870-05171 | Human BHMT AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32870-05151 | Human BHMT AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33452-05111 | Human BIF-1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33452-05121 | Human BIF-1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33452-05161 | Human BIF-1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33452-05141 | Human BIF-1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33452-05171 | Human BIF-1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33452-05151 | Human BIF-1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10911-05011 | Human Big Gastrin Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10911-05021 | Human Big Gastrin Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31230-05111 | Human Biliverdin Reductase A (BLVR A) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 31230-05121 | Human Biliverdin Reductase A (BLVR A) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 31230-05161 | Human Biliverdin Reductase A (BLVR A) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31230-05141 | Human Biliverdin Reductase A (BLVR A) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 31230-05171 | Human Biliverdin Reductase A (BLVR A) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 31230-05151 | Human Biliverdin Reductase A (BLVR A) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32704-05111 | Human BLVRB Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32704-05121 | Human BLVRB Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32704-05161 | Human BLVRB AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32704-05141 | Human BLVRB AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32704-05171 | Human BLVRB AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32704-05151 | Human BLVRB AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32558-05111 | Human BMP-2 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32558-05121 | Human BMP-2 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32558-05161 | Human BMP-2 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32558-05141 | Human BMP-2 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32558-05171 | Human BMP-2 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32558-05151 | Human BMP-2 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32759-05111 | Human BMP-4 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32759-05121 | Human BMP-4 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32759-05161 | Human BMP-4 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32759-05141 | Human BMP-4 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32759-05171 | Human BMP-4 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32759-05151 | Human BMP-4 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32204-05111 | Human BMP-5 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32204-05121 | Human BMP-5 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32204-05161 | Human BMP-5 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32204-05141 | Human BMP-5 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32204-05171 | Human BMP-5 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32204-05151 | Human BMP-5 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32701-05111 | Human BMP-7 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32701-05121 | Human BMP-7 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32701-05161 | Human BMP-7 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32701-05141 | Human BMP-7 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32701-05171 | Human BMP-7 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32701-05151 | Human BMP-7 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32576-05111 | Human BNIP1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32576-05121 | Human BNIP1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32576-05161 | Human BNIP1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32576-05141 | Human BNIP1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32576-05171 | Human BNIP1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32576-05151 | Human BNIP1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30384-05111 | Human BolA-like Protein 1 (BOLA1) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 30384-05121 | Human BolA-like Protein 1 (hBolA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 30384-05161 | Human BolA-like Protein 1 (hBolA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30384-05141 | Human BolA-like Protein 1 (hBolA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 30384-05171 | Human BolA-like Protein 1 (hBolA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 30384-05151 | Human BolA-like Protein 1 (hBolA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32521-05111 | Human BOLA3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32521-05121 | Human BOLA3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32521-05161 | Human BOLA3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32521-05141 | Human BOLA3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32521-05171 | Human BOLA3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32521-05151 | Human BOLA3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33147-05111 | Human BPGM Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33147-05121 | Human BPGM Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33147-05161 | Human BPGM AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33147-05141 | Human BPGM AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33147-05171 | Human BPGM AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33147-05151 | Human BPGM AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32217-05111 | Human BPHL Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32217-05121 | Human BPHL Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32217-05161 | Human BPHL AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32217-05141 | Human BPHL AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32217-05171 | Human BPHL AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32217-05151 | Human BPHL AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33446-05111 | Human BPI Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33446-05121 | Human BPI Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33446-05161 | Human BPI AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33446-05141 | Human BPI AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33446-05171 | Human BPI AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33446-05151 | Human BPI AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10531-05011 | Human Brain Natriuretic Peptide (BNP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10531-05021 | Human Brain Natriuretic Peptide (BNP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33128-05111 | Human BRD1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33128-05121 | Human BRD1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33128-05161 | Human BRD1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33128-05141 | Human BRD1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33128-05171 | Human BRD1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33128-05151 | Human BRD1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32575-05111 | Human BRD3 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32575-05121 | Human BRD3 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32575-05161 | Human BRD3 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32575-05141 | Human BRD3 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32575-05171 | Human BRD3 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32575-05151 | Human BRD3 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33338-05111 | Human BRDG 1 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33338-05121 | Human BRDG 1 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33338-05161 | Human BRDG 1 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33338-05141 | Human BRDG 1 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33338-05171 | Human BRDG 1 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33338-05151 | Human BRDG 1 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36818-05111 | Human Butyrylcholinesterase (BCHE) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36818-05121 | Human Butyrylcholinesterase (BCHE) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36818-05161 | Human Butyrylcholinesterase (BCHE) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36818-05141 | Human Butyrylcholinesterase (BCHE) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36818-05171 | Human Butyrylcholinesterase (BCHE) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36818-05151 | Human Butyrylcholinesterase (BCHE) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32318-05111 | Human C-C Motif Chemokine 22 (MDC) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32318-05121 | Human C-C Motif Chemokine 22 (MDC) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32318-05161 | Human C-C Motif Chemokine 22 (MDC) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32318-05141 | Human C-C Motif Chemokine 22 (MDC) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32318-05171 | Human C-C Motif Chemokine 22 (MDC) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32318-05151 | Human C-C Motif Chemokine 22 (MDC) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 18101-05071 | Human C-Reactive Protein (CRP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32990-05171 | Human C-Reactive Protein (CRP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 18101-05011 | Human C-Reactive Protein (CRP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32990-05111 | Human C-Reactive Protein (CRP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 18101-05021 | Human C-Reactive Protein (CRP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32990-05121 | Human C-Reactive Protein (CRP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 18101-05061 | Human C-Reactive Protein (CRP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32990-05161 | Human C-Reactive Protein (CRP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 18101-05041 | Human C-Reactive Protein (CRP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32990-05141 | Human C-Reactive Protein (CRP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 18101-05051 | Human C-Reactive Protein (CRP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32990-05151 | Human C-Reactive Protein (CRP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 10621-05011 | Human C-type Natriuretic Peptide (CNP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 32226-05111 | Human C-type Natriuretic Peptide (CNP) Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 10621-05021 | Human C-type Natriuretic Peptide (CNP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32226-05121 | Human C-type Natriuretic Peptide (CNP) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 32226-05161 | Human C-type Natriuretic Peptide (CNP) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32226-05141 | Human C-type Natriuretic Peptide (CNP) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 32226-05171 | Human C-type Natriuretic Peptide (CNP) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 32226-05151 | Human C-type Natriuretic Peptide (CNP) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36819-05111 | Human C1 esterase inhibitor Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36819-06111 | Human C1 esterase inhibitor Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 36819-05121 | Human C1 esterase inhibitor Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36819-06121 | Human C1 esterase inhibitor Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 36819-05151 | Human C1 esterase inhibitor Antibody AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36819-05161 | Human C1 esterase inhibitor AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 36819-05141 | Human C1 esterase inhibitor AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 36819-05171 | Human C1 esterase inhibitor AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33471-05111 | Human C11ORF79 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33471-05121 | Human C11ORF79 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33471-05161 | Human C11ORF79 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33471-05141 | Human C11ORF79 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Primary Abs | 33471-05171 | Human C11ORF79 AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33471-05151 | Human C11ORF79 AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33025-05111 | Human C1ORF41 Antibody | IgG | 150 ug |
| Polyclonal Primary Abs | 33025-05121 | Human C1ORF41 Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Primary Abs | 33025-05161 | Human C1ORF41 AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Primary Abs | 33025-05141 | Human C1ORF41 AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 40013-05011 | Bovine Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 40013-05021 | Bovine Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 40013-05061 | Bovine Immunoglobulin G (IgG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40013-05041 | Bovine Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 40013-05071 | Bovine Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40013-05051 | Bovine Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 32286-05111 | Canine Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 32286-05121 | Canine Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 32286-05161 | Canine Immunoglobulin G (IgG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 32286-05141 | Canine Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 32286-05171 | Canine Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 32286-05151 | Canine Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 45010-05011 | Chicken Immunoglobulin Y (IgY) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 45010-05021 | Chicken Immunoglobulin Y (IgY) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | DARBI01 | Donkey anti-Rat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | DARBI02 | Donkey anti-Rat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | DARFITC01 | Donkey anti-Rat IgG Secondary AssayLite Antibody (FITC Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GAGPBI01 | Goat anti-Guinea Pig IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GAGPBI02 | Goat anti-Guinea Pig IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | GAGPFITC01 | Goat anti-Guinea Pig IgG Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | GAHGBI01 | Goat anti-Human IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GAHGBI02 | Goat anti-Human IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | GAHGFITC01 | Goat anti-Human IgG-Fc Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | GAMGBI01 | Goat anti-Mouse IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GAMGBI02 | Goat anti-Mouse IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | GAMGFITC01 | Goat anti-Mouse IgG-Fc Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | GARBBI01 | Goat anti-Rabbit IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GARBBI02 | Goat anti-Rabbit IgG-Fc Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | GARBFITC01 | Goat anti-Rabbit IgG-Fc Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | GARBI01 | Goat anti-Rat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | GARBI02 | Goat anti-Rat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | GARFITC01 | Goat anti-Rat IgG Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24101-05011 | Human Immunoglobulin A (IgA) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24101-05021 | Human Immunoglobulin A (IgA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24101-05061 | Human Immunoglobulin A (IgA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24101-05041 | Human Immunoglobulin A (IgA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24101-05071 | Human Immunoglobulin A (IgA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24101-05051 | Human Immunoglobulin A (IgA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24102-05011 | Human Immunoglobulin A1 (IgA1) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24102-05021 | Human Immunoglobulin A1 (IgA1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24102-05061 | Human Immunoglobulin A1 (IgA1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24102-05041 | Human Immunoglobulin A1 (IgA1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24102-05071 | Human Immunoglobulin A1 (IgA1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24102-05051 | Human Immunoglobulin A1 (IgA1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24103-05011 | Human Immunoglobulin A2 (IgA2) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24103-05021 | Human Immunoglobulin A2 (IgA2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24103-05061 | Human Immunoglobulin A2 (IgA2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24103-05041 | Human Immunoglobulin A2 (IgA2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24103-05071 | Human Immunoglobulin A2 (IgA2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24103-05051 | Human Immunoglobulin A2 (IgA2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24111-05011 | Human Immunoglobulin D (IgD) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24111-05021 | Human Immunoglobulin D (IgD) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24111-05061 | Human Immunoglobulin D (IgD) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24111-05041 | Human Immunoglobulin D (IgD) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24111-05071 | Human Immunoglobulin D (IgD) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24111-05051 | Human Immunoglobulin D (IgD) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24159-05011 | Human Immunoglobulin E (IgE) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24159-05021 | Human Immunoglobulin E (IgE) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24159-05061 | Human Immunoglobulin E (IgE) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24159-05041 | Human Immunoglobulin E (IgE) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24159-05071 | Human Immunoglobulin E (IgE) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24159-05051 | Human Immunoglobulin E (IgE) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24133-05011 | Human Immunoglobulin G (IgG-Fab) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24133-05021 | Human Immunoglobulin G (IgG-Fab) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24133-05061 | Human Immunoglobulin G (IgG-Fab) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24133-05041 | Human Immunoglobulin G (IgG-Fab) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24133-05071 | Human Immunoglobulin G (IgG-Fab) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24133-05051 | Human Immunoglobulin G (IgG-Fab) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24132-05011 | Human Immunoglobulin G (IgG-Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24132-05021 | Human Immunoglobulin G (IgG-Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24132-05061 | Human Immunoglobulin G (IgG-Fc) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24132-05041 | Human Immunoglobulin G (IgG-Fc) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24132-05071 | Human Immunoglobulin G (IgG-Fc) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24132-05051 | Human Immunoglobulin G (IgG-Fc) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24104-05011 | Human Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24104-05021 | Human Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24104-05061 | Human Immunoglobulin G (IgG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24104-05041 | Human Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24104-05071 | Human Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24104-05051 | Human Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24105-05011 | Human Immunoglobulin G1 (IgG1) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24105-05021 | Human Immunoglobulin G1 (IgG1) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24105-05061 | Human Immunoglobulin G1 (IgG1) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24105-05041 | Human Immunoglobulin G1 (IgG1) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24105-05071 | Human Immunoglobulin G1 (IgG1) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24105-05051 | Human Immunoglobulin G1 (IgG1) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34105-05111 | Human Immunoglobulin G1-Fc (IgG1-Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 34105-05121 | Human Immunoglobulin G1-Fc (IgG1-Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 34105-05161 | Human Immunoglobulin G1-Fc (IgG1-Fc) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34105-05141 | Human Immunoglobulin G1-Fc (IgG1-Fc) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 34105-05171 | Human Immunoglobulin G1-Fc (IgG1-Fc) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34105-05151 | Human Immunoglobulin G1-Fc (IgG1-Fc) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24106-05011 | Human Immunoglobulin G2 (IgG2) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24106-05021 | Human Immunoglobulin G2 (IgG2) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24106-05061 | Human Immunoglobulin G2 (IgG2) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24106-05041 | Human Immunoglobulin G2 (IgG2) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24106-05071 | Human Immunoglobulin G2 (IgG2) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24106-05051 | Human Immunoglobulin G2 (IgG2) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34106-05111 | Human Immunoglobulin G2-Fc (IgG2-Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 34106-05121 | Human Immunoglobulin G2-Fc (IgG2-Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 34106-05161 | Human Immunoglobulin G2-Fc (IgG2-Fc) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34106-05141 | Human Immunoglobulin G2-Fc (IgG2-Fc) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 34106-05171 | Human Immunoglobulin G2-Fc (IgG2-Fc) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34106-05151 | Human Immunoglobulin G2-Fc (IgG2-Fc) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24107-05011 | Human Immunoglobulin G3 (IgG3) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24107-05021 | Human Immunoglobulin G3 (IgG3) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24107-05061 | Human Immunoglobulin G3 (IgG3) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24107-05041 | Human Immunoglobulin G3 (IgG3) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24107-05071 | Human Immunoglobulin G3 (IgG3) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24107-05051 | Human Immunoglobulin G3 (IgG3) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34107-05111 | Human Immunoglobulin G3-Fc (IgG3-Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 34107-05121 | Human Immunoglobulin G3-Fc (IgG3-Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 34107-05161 | Human Immunoglobulin G3-Fc (IgG3-Fc) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34107-05141 | Human Immunoglobulin G3-Fc (IgG3-Fc) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 34107-05171 | Human Immunoglobulin G3-Fc (IgG3-Fc) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34107-05151 | Human Immunoglobulin G3-Fc (IgG3-Fc) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24108-05011 | Human Immunoglobulin G4 (IgG4) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24108-05021 | Human Immunoglobulin G4 (IgG4) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24108-05061 | Human Immunoglobulin G4 (IgG4) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24108-05041 | Human Immunoglobulin G4 (IgG4) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24108-05071 | Human Immunoglobulin G4 (IgG4) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24108-05051 | Human Immunoglobulin G4 (IgG4) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34108-05111 | Human Immunoglobulin G4-Fc (IgG4-Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 34108-05121 | Human Immunoglobulin G4-Fc (IgG4-Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 34108-05161 | Human Immunoglobulin G4-Fc (IgG4-Fc) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34108-05141 | Human Immunoglobulin G4-Fc (IgG4-Fc) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 34108-05171 | Human Immunoglobulin G4-Fc (IgG4-Fc) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 34108-05151 | Human Immunoglobulin G4-Fc (IgG4-Fc) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 30165-05111 | Human Immunoglobulin J Chain (IGJ) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 30165-05121 | Human Immunoglobulin J Chain (IGJ) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 30165-05161 | Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 30165-05141 | Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 30165-05171 | Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 30165-05151 | Human Immunoglobulin J Chain (IGJ) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24109-05011 | Human Immunoglobulin M (IgM) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 44181-05011 | Human Immunoglobulin M (IgM) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24109-05021 | Human Immunoglobulin M (IgM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 44181-05021 | Human Immunoglobulin M (IgM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24109-05061 | Human Immunoglobulin M (IgM) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24109-05041 | Human Immunoglobulin M (IgM) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 44181-05041 | Human Immunoglobulin M (IgM) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24109-05071 | Human Immunoglobulin M (IgM) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24109-05051 | Human Immunoglobulin M (IgM) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24112-05011 | Human Secretory Immunoglobulin A (IgA) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 24112-05021 | Human Secretory Immunoglobulin A (IgA) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 24112-05061 | Human Secretory Immunoglobulin A (IgA) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24112-05041 | Human Secretory Immunoglobulin A (IgA) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 24112-05071 | Human Secretory Immunoglobulin A (IgA) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 24112-05051 | Human Secretory Immunoglobulin A (IgA) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 36813-05111 | Monkey Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 36813-05121 | Monkey Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 36813-05161 | Monkey Immunoglobulin G (IgG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 36813-05141 | Monkey Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 36813-05171 | Monkey Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 36813-05151 | Monkey Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40011-05011 | Mouse Immunoglobulin G (IgG) (Fc) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 40011-05021 | Mouse Immunoglobulin G (IgG) (Fc) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 40012-05011 | Mouse Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 40012-05021 | Mouse Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 40012-05041 | Mouse Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 40012-05071 | Mouse Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40012-05051 | Mouse Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40012-05061 | Mouse Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20511-05011 | Mouse Immunoglobulin M Kappa (IgM) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 20511-05021 | Mouse Immunoglobulin M Kappa (IgM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 20511-05061 | Mouse Immunoglobulin M Kappa (IgM) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20511-05041 | Mouse Immunoglobulin M Kappa (IgM) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 20511-05071 | Mouse Immunoglobulin M Kappa (IgM) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20511-05051 | Mouse Immunoglobulin M Kappa (IgM) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20512-05011 | Mouse Immunoglobulin M Lambda (IgM) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 20512-05021 | Mouse Immunoglobulin M Lambda (IgM) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 20512-05061 | Mouse Immunoglobulin M Lambda (IgM) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20512-05041 | Mouse Immunoglobulin M Lambda (IgM) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 20512-05071 | Mouse Immunoglobulin M Lambda (IgM) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 20512-05051 | Mouse Immunoglobulin M Lambda (IgM) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RAGBI01 | Rabbit anti-Goat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | RAGBI02 | Rabbit anti-Goat IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | RAGAPC01 | Rabbit anti-Goat IgG Secondary AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RAGFITC01 | Rabbit anti-Goat IgG Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | RAGPER01 | Rabbit anti-Goat IgG Secondary AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RAGRPE01 | Rabbit anti-Goat IgG Secondary AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RASBI01 | Rabbit anti-Sheep IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | RASBI02 | Rabbit anti-Sheep IgG Secondary Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 400 ug |
| Polyclonal Secondary Abs | RASAPC01 | Rabbit anti-Sheep IgG Secondary AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RASFITC01 | Rabbit anti-Sheep IgG Secondary AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | RASPER01 | Rabbit anti-Sheep IgG Secondary AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | RASRPE01 | Rabbit anti-Sheep IgG Secondary AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40532-05011 | Rabbit Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 40532-05021 | Rabbit Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 40532-05041 | Rabbit Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 40113-05011 | Sheep Immunoglobulin G (IgG) Antibody | IgG | 150 ug |
| Polyclonal Secondary Abs | 40113-05021 | Sheep Immunoglobulin G (IgG) Antibody (Biotin Conjugate) | IgG-Biotin Conjugate | 150 ug |
| Polyclonal Secondary Abs | 40113-05061 | Sheep Immunoglobulin G (IgG) AssayLite Antibody (APC Conjugate) | IgG-APC Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40113-05041 | Sheep Immunoglobulin G (IgG) AssayLite Antibody (FITC Conjugate) | IgG-FITC Conjugate | 2 x 75 ug |
| Polyclonal Secondary Abs | 40113-05071 | Sheep Immunoglobulin G (IgG) AssayLite Antibody (PerCP Conjugate) | IgG-PerCP Conjugate | 5 x 30 ug |
| Polyclonal Secondary Abs | 40113-05051 | Sheep Immunoglobulin G (IgG) AssayLite Antibody (RPE Conjugate) | IgG-RPE Conjugate | 5 x 30 ug |
| Deficient Products | D250004 | Human Adiponectin (ACRP30) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D250007 | Human Adiponectin (ACRP30) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D250001 | Human Adiponectin (ACRP30) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D250010 | Human Adiponectin (ACRP30) Deficient Serum | Serum | 1 ml |
| Deficient Products | D500104 | Human Alpha-1-Antitrypsin Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D500107 | Human Alpha-1-Antitrypsin Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D500101 | Human Alpha-1-Antitrypsin Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D500110 | Human Alpha-1-Antitrypsin Deficient Serum | Serum | 1 ml |
| Deficient Products | D265014 | Human Amylase Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D265017 | Human Amylase Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D265011 | Human Amylase Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D265010 | Human Amylase Deficient Plasma Deficient Serum | Plasma | 1 ml |
| Deficient Products | D330104 | Human Antithrombin III Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D330107 | Human Antithrombin III Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D330101 | Human Antithrombin III Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D330110 | Human Antithrombin III Deficient Serum | Serum | 1 ml |
| Deficient Products | D100104 | Human C-Reactive Protein (CRP) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D100107 | Human C-Reactive Protein (CRP) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D100101 | Human C-Reactive Protein (CRP) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D100110 | Human C-Reactive Protein (CRP) Deficient Serum | Serum | 1 ml |
| Deficient Products | D710104 | Human Complement C1q Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D710107 | Human Complement C1q Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D710101 | Human Complement C1q Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D710110 | Human Complement C1q Deficient Serum | Serum | 1 ml |
| Deficient Products | DD7101210 | Human Complement C1q/C4 Deficient Serum | Serum | 1 ml |
| Deficient Products | D210104 | Human Complement C3 Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D210107 | Human Complement C3 Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D210101 | Human Complement C3 Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D210110 | Human Complement C3 Deficient Serum | Serum | 1 ml |
| Deficient Products | D210204 | Human Complement C4 Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D210207 | Human Complement C4 Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D210201 | Human Complement C4 Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D210210 | Human Complement C4 Deficient Serum | Serum | 1 ml |
| Deficient Products | D510104 | Human Complement C5 Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D510107 | Human Complement C5 Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D510101 | Human Complement C5 Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D510110 | Human Complement C5 Deficient Serum | Serum | 1 ml |
| Deficient Products | D700104 | Human Complement Factor B Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D700107 | Human Complement Factor B Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D700101 | Human Complement Factor B Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D700110 | Human Complement Factor B Deficient Serum | Serum | 1 ml |
| Deficient Products | D770104 | Human Complement Factor D Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D770107 | Human Complement Factor D Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D770101 | Human Complement Factor D Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D770110 | Human Complement Factor D Deficient Serum | Serum | 1 ml |
| Deficient Products | D700504 | Human Complement Factor H Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D700507 | Human Complement Factor H Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D700501 | Human Complement Factor H Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D700510 | Human Complement Factor H Deficient Serum | Serum | 1 ml |
| Deficient Products | D100904 | Human Factor IX (Factor 9) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D100907 | Human Factor IX (Factor 9) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D100901 | Human Factor IX (Factor 9) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D100910 | Human Factor IX (Factor 9) Deficient Serum | Serum | 1 ml |
| Deficient Products | D100504 | Human Factor V (Factor 5) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D100507 | Human Factor V (Factor 5) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D100501 | Human Factor V (Factor 5) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D100510 | Human Factor V (Factor 5) Deficient Serum | Plasma | 1 ml |
| Deficient Products | D100704 | Human Factor VII (Factor 7) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D100707 | Human Factor VII (Factor 7) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D100701 | Human Factor VII (Factor 7) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D100710 | Human Factor VII (Factor 7) Deficient Serum | Serum | 1 ml |
| Deficient Products | D101004 | Human Factor X (Factor 10) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D101007 | Human Factor X (Factor 10) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D101001 | Human Factor X (Factor 10) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D101010 | Human Factor X (Factor 10) Deficient Serum | Serum | 1 ml |
| Deficient Products | D101104 | Human Factor XI (Factor 11) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D101107 | Human Factor XI (Factor 11) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D101101 | Human Factor XI (Factor 11) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D101110 | Human Factor XI (Factor 11) Deficient Serum | Serum | 1 ml |
| Deficient Products | D101204 | Human Factor XII (Factor 12) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D101207 | Human Factor XII (Factor 12) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D101201 | Human Factor XII (Factor 12) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D101210 | Human Factor XII (Factor 12) Deficient Serum | Serum | 1 ml |
| Deficient Products | D101304 | Human Factor XIII (Factor 13) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D101307 | Human Factor XIII (Factor 13) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D101301 | Human Factor XIII (Factor 13) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D101310 | Human Factor XIII (Factor 13) Deficient Serum | Serum | 1 ml |
| Deficient Products | D502514 | Human Ferritin Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D502517 | Human Ferritin Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D502501 | Human Ferritin Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D502510 | Human Ferritin Deficient Serum | Serum | 1 ml |
| Deficient Products | D131104 | Human Kininogen (HMW) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D131107 | Human Kininogen (HMW) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D131101 | Human Kininogen (HMW) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D131110 | Human Kininogen (HMW) Deficient Serum | Serum | 1 ml |
| Deficient Products | D650104 | Human Myeloperoxidase (MPO) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D650107 | Human Myeloperoxidase (MPO) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D650101 | Human Myeloperoxidase (MPO) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D650110 | Human Myeloperoxidase (MPO) Deficient Serum | Plasma | 1 ml |
| Deficient Products | HPNPE | Human Normal Pooled Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | HPNPH | Human Normal Pooled Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | HPNPC | Human Normal Pooled Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | HPNS | Human Normal Pooled Serum | Plasma | 1 ml |
| Deficient Products | D120004 | Human Plasminogen Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D120007 | Human Plasminogen Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D120001 | Human Plasminogen Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D120010 | Human Plasminogen Deficient Serum | Plasma | 1 ml |
| Deficient Products | D133304 | Human Protein C Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D133307 | Human Protein C Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D133301 | Human Protein C Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D133310 | Human Protein C Deficient Serum | Plasma | 1 ml |
| Deficient Products | D133104 | Human Protein S Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D133107 | Human Protein S Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D133101 | Human Protein S Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D133110 | Human Protein S Deficient Serum | Serum | 1 ml |
| Deficient Products | D800104 | Human Serum Amyloid A (SAA) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D800107 | Human Serum Amyloid A (SAA) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D800101 | Human Serum Amyloid A (SAA) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D800110 | Human Serum Amyloid A (SAA) Deficient Serum | Serum | 1 ml |
| Deficient Products | D820104 | Human Serum Amyloid P Component (SAP) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D820107 | Human Serum Amyloid P Component (SAP) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D820101 | Human Serum Amyloid P Component (SAP) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D820110 | Human Serum Amyloid P Component (SAP) Deficient Serum | Serum | 1 ml |
| Deficient Products | D110107 | Human tPA Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D110104 | Human tPA Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D110101 | Human tPA Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D110110 | Human tPA Deficient Serum | Serum | 1 ml |
| Deficient Products | D203004 | Human Von Willebrand Factor (VWF) Deficient Plasma (EDTA) | Plasma | 1 ml |
| Deficient Products | D203007 | Human Von Willebrand Factor (VWF) Deficient Plasma (Heparin) | Plasma | 1 ml |
| Deficient Products | D203001 | Human Von Willebrand Factor (VWF) Deficient Plasma (Sodium Citrate) | Plasma | 1 ml |
| Deficient Products | D203010 | Human Von Willebrand Factor (VWF) Deficient Serum | Serum | 1 ml |

艾美捷科技代理SeraCare对照及参比物质。
艾美捷科技有限公司,自2018年与SeraCare(现隶属于LGC Clinical Diagnostics)合作以来,长期为中国客户提供包括SeraSeq系列参比物质,领域包括肿瘤、生殖健康和遗传病。SeraCare研发和生产一系列临床参比物质,可以用于任何研发阶段,以确保临床基因组学检测结果的准确性。
SeraCare参比物质涵盖的范围:
1)Next Generation Sequencing
2)Sanger Sequencing
3)Real-time PCR and digital PCR (dPCR)
4)Microarray
主要特点
1)Ready-to-use reference materials covering clinically-relevant variants and all variant types - SNVs, INDELS, CNVs, and RNA fusions
2)Highly multiplexed - provide significantly more data per NGS run, saving sequencing costs
3)Available in multiple formats to suite different workflow needs - purified DNA & RNA, ctDNA, encapsulated ctDNA in plasma, and FFPE
4)Manufactured in cGMP-compliant, ISO 13485-certified facilities
5)Stringent product release testing - all variants qualified by dPCR for allele frequencies or copy numbers
| 参比物质 | 货号 | 规格 |
| Seraseq® Whole Transcriptome RNA Seq Mix | 0710-2129 | 1 x 20 µl |
| Seraseq® Unmethylated ctDNA Mutation Mix | 0710-3088 | 1 x 25 µl |
| Seraseq® Tumor Mutation DNA Mix v2 AF 7 HC | 0710-0095 | 1 x 25 µl |
| Seraseq® Tumor Mutation DNA Mix v2 AF 10 HC | 0710-0094 | 1 x 25 µl |
| Seraseq® Tri-Level Tumor Mutation DNA Mix v2 HC | 0710-0097 | 1 x 25 µl |
| Seraseq® TNA (DNA/RNA) WT Mix | 0710-1580 | 2 x 20 µl |
| Seraseq® Solid Tumor CNV Mix, +6 copies | 0710-2867 | 1 x 20 µl |
| Seraseq® Solid Tumor CNV Mix, +3 copies | 0710-2866 | 1 x 20 µl |
| Seraseq® Solid Tumor CNV Mix, +12 copies | 0710-2868 | 1 x 20 µl |
| Seraseq® NTRK Fusion RNA Mix | 0710-1696 | 1 x 20 µl |
| Seraseq® Myeloid Mutation DNA Mix | 0710-0408 | 1 x 25 µl |
| Seraseq® Myeloid Fusion RNA Mix | 0710-0407 | 1 x 25 µl |
| Seraseq Myeloid ctDNA Mix WT | 0710-2646 | 1 x 25 µl |
| Seraseq Myeloid ctDNA Mix AF1% | 0710-2649 | 1 x 25 µl |
| Seraseq Myeloid ctDNA Mix AF0.5% | 0710-2648 | 1 x 25 µl |
| Seraseq Myeloid ctDNA Mix AF0.1% | 0710-2647 | 1 x 25 µl |
| Seraseq® MSI Reference Panel Mix AF5% | 0710-1675 | 2 x 15 µl |
| Seraseq® MSI Reference Panel Mix AF20% | 0710-1676 | 2 x 15 µl |
| Seraseq® Methylated ctDNA Mutation Mix | 0710-3089 | 1 x 25 µl |
| Seraseq® Lymphoma DNA Mutation Mix | 0710-2203 | 1 x 25 µl |
| Seraseq™ Lung & Brain CNV Mix, + 6 copies | 0710-0415 | 1 x 20 µl |
| Seraseq® Lung & Brain CNV Mix, + 3 copies | 0710-0414 | 1 x 20 µl |
| Seraseq® Lung & Brain CNV Mix, + 12 copies | 0710-0416 | 1 x 20 µl |
| Seraseq® HRD gDNA Negative Mix | 0710-2881 | 2 x 20 µl |
| Seraseq® HRD gDNA Low-Positive Mix | 0710-2880 | 2 x 20 µl |
| Seraseq® HRD gDNA High-Positive Mix | 0710-2879 | 2 x 20 µl |
| Seraseq® gDNA TMB Reference Panel Mix | 0710-2463 | 5 x 20 µl |
| Seraseq® gDNA TMB Mix Score 9 | 0710-1325 | 2 x 500 ng |
| Seraseq® gDNA TMB Mix Score 7 | 0710-1326 | 2 x 500 ng |
| Seraseq® gDNA TMB Mix Score 26 | 0710-1323 | 2 x 500 ng |
| Seraseq® gDNA TMB Mix Score 20 | 0710-1324 | 2 x 500 ng |
| Seraseq® gDNA TMB Mix Score 13 | 0710-1586 | 2 x 10 µl |
| Seraseq® gDNA MSI-High Mix | 0710-1670 | 1 x 20 µl |
| Seraseq® gDNA BRCA1/2 LGR Somatic Mutation Mix | 0730-0567 | 1 x 25 µl |
| Seraseq® gDNA BRCA1/2 LGR Inherited Mutation Mix | 0730-0568 | 1 x 25 µl |
| Seraseq® Fusion RNA Mix v4 | 0710-0497 | 1 x 25 µl |
| Seraseq® FFPE WT (DNA/RNA) Reference Material | 0710-0137 | 1 x 10 µm |
| Seraseq® FFPE TMB RM Score 9 | 0710-1308 | 2 x 10 µm |
| Seraseq® FFPE TMB RM Score 7 | 0710-1310 | 2 x 10 µm |
| Seraseq® FFPE TMB RM Score 26 | 0710-1307 | 2 x 10 µm |
| Seraseq® FFPE TMB RM Score 20 | 0710-1309 | 2 x 10 µm |
| Seraseq® FFPE TMB RM Score 13 | 0710-1618 | 2 x 10 um |
| Seraseq® FFPE Solid Tumor CNV Reference Materials | 0710-2865 | 1 x 10 µm |
| Seraseq® FFPE NTRK Fusion RNA Reference Material | 0710-1031 | 1 x 10 µm |
| Seraseq® FFPE MSI-High RM | 0710-2236 | 1 x 10 um |
| Seraseq® FFPE Lymphoma DNA Reference Material | 0710-2202 | 1 x 10 µm |
| Seraseq® FFPE HRD Negative RM | 0710-2644 | 1 x 10 µm |
| Seraseq® FFPE HRD Low-Positive RM | 0710-2645 | 1 x 10 µm |
| Seraseq® FFPE HRD High-Positive RM | 0710-2643 | 1 x 10 µm |
| Seraseq® FFPE Tumor Fusion RNA v4 Reference Material | 0710-0496 | 1 x 10 µm |
| Seraseq® FFPE BRCA1/2 LGR Reference Material | 0730-0564 | 1 x 10 µm |
| Seraseq® ctDNA Reference Material v2 WT | 0710-0208 | 1 x 5 mL |
| Seraseq® ctDNA Reference Material v2 AF2% | 0710-0203 | 1 x 5 mL |
| Seraseq® ctDNA Reference Material v2 AF1% | 0710-0204 | 1 x 5 mL |
| Seraseq® ctDNA Reference Material v2 AF0.5% | 0710-0205 | 1 x 5 mL |
| Seraseq® ctDNA Reference Material v2 AF0.125% | 0710-0207 | 1 x 5 mL |
| Seraseq® ctDNA Mutation Mix v2 WT | 0710-0144 | 1 x 25 µl |
| Seraseq® ctDNA Mutation Mix v2 AF2% | 0710-0139 | 1 x 25 µl |
| Seraseq® ctDNA Mutation Mix v2 AF1% | 0710-0140 | 1 x 25 µl |
| Seraseq® ctDNA Mutation Mix v2 AF0.5% | 0710-0141 | 1 x 25 µl |
| Seraseq® ctDNA Mutation Mix v2 AF0.25% | 0710-0142 | 1 x 25 µl |
| Seraseq® ctDNA Mutation Mix v2 AF0.125% | 0710-0143 | 1 x 25 µl |
| Seraseq® ctDNA MRD Panel Mix | 0710-2146 | 4 x 20 µl |
| Seraseq® ctDNA Complete™ Reference Material WT (0%) | 0710-0674 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Reference Material AF5% | 0710-0669 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Reference Material AF2.5% | 0710-0670 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Reference Material AF1% | 0710-0671 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Reference Material AF0.5% | 0710-0672 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Reference Material AF0.1% | 0710-0673 | 1 x 5 mL |
| Seraseq® ctDNA Complete™ Mutation Mix WT (0%) | 0710-0533 | 1 x 25 µl |
| Seraseq® ctDNA Complete™ Mutation Mix AF5% | 0710-0528 | 1 x 25 µl |
| Seraseq® ctDNA Complete™ Mutation Mix AF2.5% | 0710-0529 | 1 x 25 µl |
| Seraseq® ctDNA Complete™ Mutation Mix AF1% | 0710-0530 | 1 x 25 µl |
| Seraseq® ctDNA Complete™ Mutation Mix AF0.5% | 0710-0531 | 1 x 25 µl |
| Seraseq® ctDNA Complete™ Mutation Mix AF0.1% | 0710-0532 | 1 x 25 µl |
| Seraseq® Compromised FFPE WT (DNA/RNA) RM | 0710-1710 | 1 x 10 µm |
| Seraseq® Compromised FFPE Tumor DNA RM | 0710-1492 | 1 x 10 µm |
| Seraseq® Breast CNV Mix, + 6 copies | 0710-0412 | 1 x 20 µl |
| Seraseq® Breast CNV Mix, + 3 copies | 0710-0411 | 1 x 20 µl |
| Seraseq® Breast CNV Mix, + 12 copies | 0710-0413 | 1 x 20 µl |
| Seraseq® Blood TMB Mix Score 7 | 0710-2087 | 3 x 20 µl |
| Seraseq® Blood TMB Mix Score 26 | 0710-2090 | 3 x 20 µl |
| Seraseq® Blood TMB Mix Score 20 | 0710-2089 | 3 x 20 µl |
| Seraseq® Blood TMB Mix Score 13 | 0710-2088 | 3 x 20 µl |
| Seraseq® Turner Syndrome (XO) Reference Material | 0720-0952 | 1 x 1 mL |
| Seraseq® Trisomy 21 Male-Matched Reference Material | 0720-0167 | 1 x 1 mL |
| Seraseq® Trisomy 21 Female-Matched Reference Material | 0720-0168 | 1 x 1 mL |
| Seraseq® Trisomy 18 Male-Matched Reference Material | 0720-0171 | 1 x 1 mL |
| Seraseq® Trisomy 18 Female-Matched Reference Material | 0720-0172 | 1 x 1 mL |
| Seraseq® Trisomy 13 Male-Matched Reference Material | 0720-0779 | 1 x 1 mL |
| Seraseq® Trisomy 13 Female-Matched Reference Material | 0720-0780 | 1 x 1 mL |
| Seraseq® Triple X Syndrome (XXX) Reference Material | 0720-1069 | 1 x 1 mL |
| Seraseq® PGT-A Trisomy 21 Reference Material | 0720-0775 | 1 x 10 µl |
| Seraseq® PGT-A Trisomy 18 Reference Material | 0720-0776 | 1 x 10 µl |
| Seraseq® PGT-A Trisomy 13 Reference Material | 0720-0777 | 1 x 10 µl |
| Seraseq® PGT-A Euploid Reference Material | 0720-0778 | 1 x 10 µl |
| Seraseq® Klinefelter Syndrome (XXY) Reference Material | 0720-0953 | 1 x 1 mL |
| Seraseq® Jacobs Syndrome (XYY) Reference Material | 0720-0954 | 1 x 1 mL |
| Seraseq® Euploid Male-Matched Reference Material | 0720-0169 | 1 x 1 mL |
| Seraseq® Euploid Female-Matched Reference Material | 0720-0170 | 1 x 1 mL |
| Seraseq® 22q11 Male-Matched Reference Material | 0720-0173 | 1 x 1 mL |
| Seraseq® 22q11 Female-Matched Reference Material | 0720-0174 | 1 x 1 mL |
| Seraseq® Inherited Cancer DNA Mix v1 | 0730-0003 | 1 x 200 µL |
| Seraseq® gDNA BRCA1/2 LGR Inherited Mutation Mix | 0730-0568 | 1 x 25 µL |
| Seraseq® FFPE BRCA1/2 LGR Reference Material | 0730-0564 | 1 x 10 µm |
| Seraseq® Cardiomyopathy Reference Material | 0740-0021 | 1 x 200 µL |

艾美捷科技代理OV (Ohio Valley Specialty Company) 品牌全系列产品。

OV (Ohio Valley Specialty)(俄亥俄特殊化学品公司)位于Ohio州Marietta,专注于气相色谱相关产品。
主要产品包括:
气相色谱柱填料
气相色谱固定相
固体载体
硅烷化试剂
<更多详情请联系
艾美捷科技有限公司
全国服务热线:400-6800-868
邮箱:sales@amyjet.com
网站:www.amyjet.com
" data-original="http://genvivo.51antibodies.com/template/company/xys_lvse/skin/image/lazyLoad.jpg" alt="Ohio Valley Specialty Company (OVSC)"> Ohio Valley Specialty Company (OVSC)
艾美捷科技特约代理Alpco全系列产品
Alpco公司从成立初期就致力于生物医药领域各种免疫检测试剂盒的研发与生产,力求为广大客户提供高质量的免疫检测产品。ALPCO产品种类多样,可测样品来源包括人、大/小鼠、豚鼠、兔、猪、羊、狗、猴等,涉及神经生物学、骨代谢、心血管疾病和氧化应激、细胞因子与信号转导、糖尿病和肥胖症、内分泌学、甲状腺功能、肠胃病学、免疫学、生殖激素、抗体和抗原、分子诊断等多个研究领域,尤以糖尿病和肥胖症研究领域见长。
ALPCO offers a wide range of testing solutions, providing scientists and healthcare professionals with vital insights for advancing research and quality of care.
Alpco公司的主要产品包括:
Immunoassays
Flow Cytometry
HPLC/LC-MS
Chemiluminescence
按照研究领域细分
Antibodies & Antigens
Allergy & Infectious Disease
Bone Metabolism
CVD & Oxidative Health
Diabetes & Obesity
Endocrinology
Gastroenterology
Immunology
Neurobiology
Toxicology
" data-original="http://genvivo.51antibodies.com/template/company/xys_lvse/skin/image/lazyLoad.jpg" alt="艾美捷科技特约代理Alpco全系列产品"> 艾美捷科技特约代理Alpco全系列产品
<艾美捷科技代理Box scientific品牌全系列产品
BOX Scientific是一家专注于生命科学领域基于对流的解冻平台的生产商。自2010年在加利福尼亚圣何塞成立以来,BOX Scientific始终致力于程序化样品解冻技术,旨在保持样品完整性、控制过程变异性,并提高临床应用中的数据质量。公司由资深人士Derek Donohue领导,他在制药和基因组诊断领域拥有丰富经验。BOX Scientific的产品以其多功能性、大容量和高速解冻能力,树立了快速、安全和可重复的样品解冻新标准。公司产品包括工位一架解冻站(Station One)、直升机场机架解冻站(Heliport)。

▍BOX Scientific公司产品线
●工位一架解冻站(Station One)
仅使用环境空气即可在极短的时间内解冻冷冻试剂和样品。固定平台设计,实现高通量样品解冻,满足精细样品和试剂的解冻需求。样品和试剂的解冻过程可重复、可程序化,且安全可靠。应用场景:
※适用于需要快速解冻且保持样品完整性的实验室环境。
※特别适用于临床研究和生物样本库管理,确保样品在解冻过程中的稳定性和一致性。
● 直升机场机架解冻站(Heliport)
采用与Station One相同的对流原理,是市场上最大的样品解冻系统。具备自动化集成功能,是首款实现自动化集成的解冻系统。强大的对流系统能将解冻时间缩短多达75%,同时允许解冻后的样品直接无缝过渡到后续自动化流程中。应用场景:
※适用于大规模样品解冻需求,如生物样本库、临床研究机构等。
※特别适用于需要高度自动化和高效解冻的实验室环境,提升整体工作流程的效率和准确性。
▍Box scientific产品列表
<| 货号 | 品名 |
| 1-300-0725 | Station One Rack Thawing Station |
| 1-300-70000 | The Heliport Thawing Station |

艾美捷科技代理PeproTech全系列产品。产品列表如下:
| 品名 | 货号 | 规格 |
| Anti-Murine B7-1 | 500-P128-1MG | 1MG |
| Biotinylated Anti-Murine B7-1 | 500-P128Bt-1MG | 1MG |
| Recombinant Human sIL-18 Receptor α Fc | 200-15RA-500UG | 500UG |
| Recombinant Human sIL-16 Receptor α Fc | 200-15RA-100UG | 100UG |
| Human Leptin | 300-27-1000UG | 1000UG |
| Anti-Murine B7-1 | 500-P128-50UG | 50UG |
| Human GDF-3 | AF-120-22-20UG | 20UG |
| Human Vitronectin | AF-140-09-100UG | 100UG |
| Human IL-1beta | AF-200-01B-500UG | 500UG |
| Human IL-3 | AF-200-03-1MG | 1MG |
| Human IL-5 | AF-200-05-2UG | 2UG |
| Human IL-8 (CXCL8) (72 a.a.) | AF-200-08M-500UG | 500UG |
| Human IL-10 | AF-200-10-50UG | 50UG |
| Human IL-16 (121 a.a.) | AF-200-16A-1MG | 1MG |
| Human IL-17A | AF-200-17-100UG | 100UG |
| Human IL-17A | AF-200-17-250UG | 250UG |
| Human IL-22 | AF-200-22-100UG | 100UG |
| Human IL-33 | AF-200-33-100UG | 100UG |
| Human IL-33 | AF-200-33-10UG | 10UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-2UG | 2UG |
| Murine IL-22 | AF-210-22-10UG | 10UG |
| Murine IL-10 | AF-210-10-1MG | 1MG |
| Murine IL-1beta | AF-211-11B-100UG | 100UG |
| Murine IL-4 | AF-214-14-100UG | 100UG |
| Murine SCF | AF-250-03-1MG | 1MG |
| Murine G-CSF | AF-250-05-250UG | 250UG |
| Human GM-CSF | AF-300-03-5UG | 5UG |
| Human RANTES (CCL5) | AF-300-06-500UG | 500UG |
| Animal-Free Recombinant Human Oncostatin M (209 a.a.) | AF-300-10T-500UG | 500UG |
| Human MCP-2 (CCL8) | AF-300-15-2UG | 2UG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-2UG | 2UG |
| Human TECK (CCL25) | AF-300-45-250UG | 250UG |
| Human Apo-SAA1 | AF-300-53-1MG | 1MG |
| Human C5a | AF-300-70-100UG | 100UG |
| Human sRANK Ligand (E.coli derived) | AF-310-01-10UG | 10UG |
| Human TWEAK | AF-310-06-5UG | 5UG |
| Human sTNF Receptor Type I | AF-310-07-500UG | 500UG |
| Human 4-1BB Ligand | AF-310-11-20UG | 20UG |
| Animal-Free Recombinant Human Heregulinbeta-1 | AF-100-03-10UG | 10UG |
| Human IL-1alpha | AF-200-01A-100UG | 100UG |
| Human IL-1RA | AF-200-01RA-20UG | 20UG |
| Human IL-1RA | AF-200-01RA-250UG | 250UG |
| Human IL-4 | AF-200-04-500UG | 500UG |
| Human IL-5 | AF-200-05-100UG | 100UG |
| Human IL-7 | AF-200-07-250UG | 250UG |
| Human IL-8 (CXCL8) (72 a.a.) | AF-200-08M-25UG | 25UG |
| Human IL-9 | AF-200-09-100UG | 100UG |
| Human IL-13 | AF-200-13-50UG | 50UG |
| Human IL-13 | AF-200-13-1MG | 1MG |
| Human IL-17A | AF-200-17-1MG | 1MG |
| Human IL-17F | AF-200-25-250UG | 250UG |
| Human IL-33 | AF-200-33-1MG | 1MG |
| Murine IL-21 | AF-210-21-10UG | 10UG |
| Murine G-CSF | AF-250-05-100UG | 100UG |
| Human IFN-lambda1 | AF-300-02L-100UG | 100UG |
| Human RANTES (CCL5) | AF-300-06-250UG | 250UG |
| Human MIP-1alpha (CCL3) | AF-300-08-100UG | 100UG |
| Human GRO-alpha/MGSA (CXCL1) | AF-300-11-1mg | 1MG |
| Human TPO | AF-300-18-250UG | 250UG |
| Human Eotaxin (CCL11) | AF-300-21-500UG | 500UG |
| Human G-CSF | AF-300-23-50UG | 50UG |
| Human TECK (CCL25) | AF-300-45-20UG | 20UG |
| Human TECK (CCL25) | AF-300-45-1MG | 1MG |
| Human I-TAC (CXCL11) | AF-300-46-100UG | 100UG |
| Human Apo-SAA1 | AF-300-53-10UG | 10UG |
| Human sRANK Ligand (E.coli derived) | AF-310-01-50UG | 50UG |
| Human sCD40 Ligand | AF-310-02-50UG | 50UG |
| Human sTNF Receptor Type I | AF-310-07-100UG | 100UG |
| Human BAFF | AF-310-13-5UG | 5UG |
| Human BAFF | AF-310-13-250UG | 250UG |
| Human GDF-3 | AF-120-22-50UG | 50UG |
| Human IL-1alpha | AF-200-01A-250UG | 250UG |
| Human IL-1beta | AF-200-01B-10UG | 10UG |
| Human IL-1beta | AF-200-01B-1MG | 1MG |
| Human IL-2 | AF-200-02-1MG | 1MG |
| Human IL-3 | AF-200-03-500UG | 500UG |
| Human IL-7 | AF-200-07-2UG | 2UG |
| Human IL-10 | AF-200-10-500UG | 500UG |
| Human IL-16 (121 a.a.) | AF-200-16A-2UG | 2UG |
| Human IL-21 | AF-200-21-500UG | 500UG |
| Human IL-22 | AF-200-22-250UG | 250UG |
| Human IL-17E | AF-200-24-100UG | 100UG |
| Human IL-17F | AF-200-25-25UG | 25UG |
| Human IL-17D | AF-200-27-1MG | 1MG |
| Human IL-33 | AF-200-33-50UG | 50UG |
| Human IL-37 (IL-1F7) | AF-200-39-100UG | 100UG |
| Murine IL-10 | AF-210-10-500UG | 500UG |
| Murine IL-6 | AF-216-16-10UG | 10UG |
| Murine SCF | AF-250-03-2UG | 2UG |
| Human GM-CSF | AF-300-03-50UG | 50UG |
| Animal-Free Recombinant Human Oncostatin M (209 a.a.) | AF-300-10T-10UG | 10UG |
| Human MCP-2 (CCL8) | AF-300-15-10UG | 10UG |
| Human TPO | AF-300-18-50UG | 50UG |
| Human TPO | AF-300-18-1MG | 1MG |
| Human Eotaxin (CCL11) | AF-300-21-20UG | 20UG |
| Human Eotaxin (CCL11) | AF-300-21-1MG | 1MG |
| Human G-CSF | AF-300-23-250UG | 250UG |
| Human I-TAC (CXCL11) | AF-300-46-20UG | 20UG |
| Human Apo-SAA1 | AF-300-53-100UG | 100UG |
| Human BD-5 | AF-300-68-5UG | 5UG |
| Rat RANTES (CCL5) | 400-13-5UG | 5UG |
| Rat RANTES (CCL5) | 400-13-50UG | 50UG |
| Rat IL-13 (113 a.a.) | 400-16L-500UG | 500UG |
| Rat IL-9 | 400-18-500UG | 500UG |
| Rat IFN-gamma | 400-20-500UG | 500UG |
| Rat GM-CSF | 400-23-20UG | 20UG |
| Rat IL-15 | 400-24-100UG | 100UG |
| Rat sRANK Ligand | 400-30-500UG | 500UG |
| Rat SDF-1alpha (CXCL12) | 400-32A-1MG | 1MG |
| Rat IP-10 (CXCL10) | 400-33-5UG | 5UG |
| Rat G-CSF | 400-37-500UG | 500UG |
| Rat IL-21 | 400-41-100UG | 100UG |
| Human MMP-2 | 420-02-50UG | 50UG |
| Human MMP-3 | 420-03-2UG | 2UG |
| Human CDNF | 450-05-1MG | 1MG |
| Human Neurturin | 450-11-20UG | 20UG |
| Human Persephin | 450-12-5UG | 5UG |
| Human Persephin | 450-12-250UG | 250UG |
| Human Artemin | 450-17-20UG | 20UG |
| Human NNT-1/BCSF-3 | 450-18-1MG | 1MG |
| Human Resistin | 450-19-50UG | 50UG |
| Human gAcrp30/Adipolean Variant | 450-20-250UG | 250UG |
| Murine RELMgamma | 450-26G-500UG | 500UG |
| Murine gAcrp30 | 450-27-250UG | 250UG |
| Murine Resistin | 450-28-5UG | 5UG |
| Murine RELMbeta | 450-26B-500UG | 500UG |
| Murine Persephin | 450-35-20UG | 20UG |
| Human Galectin-3 | 450-38-250UG | 250UG |
| Human Furin | 450-47-50UG | 50UG |
| Human Enterokinase | 450-48C-250UG | 250UG |
| Lysobacter Enzymogenes Arg-C | 450-54-5UG | 5UG |
| Murine Artemin | 450-58-500UG | 500UG |
| Rat GRO-beta/MIP-2 (CXCL2) | 400-11-1MG | 1MG |
| Rat MIP-1alpha (CCL3) | 400-15-500UG | 500UG |
| Rat MIP-1alpha (CCL3) | 400-15-1MG | 1MG |
| Rat IL-9 | 400-18-2UG | 2UG |
| Rat IL-9 | 400-18-100UG | 100UG |
| Rat IL-10 | 400-19-1MG | 1MG |
| Rat Leptin | 400-21-200UG | 200UG |
| Rat IL-15 | 400-24-2UG | 2UG |
| Rat IL-15 | 400-24-1MG | 1MG |
| Rat Fractalkine (CX3CL1) | 400-26-100UG | 100UG |
| Rat M-CSF | 400-28-100UG | 100UG |
| Rat M-CSF | 400-28-250UG | 250UG |
| Rat sRANK Ligand | 400-30-100UG | 100UG |
| Rat SDF-1alpha (CXCL12) | 400-32A-2UG | 2UG |
| Rat IP-10 (CXCL10) | 400-33-1MG | 1MG |
| Rat TPO | 400-34-100UG | 100UG |
| Recombinant Rat Oncostatin M | 400-36-250UG | 250UG |
| Rat IL-21 | 400-41-250UG | 250UG |
| Human TIMP-2 | 410-02-2UG | 2UG |
| Human OPG | 450-14-500UG | 500UG |
| Human Artemin | 450-17-250UG | 250UG |
| Human Midkine | 450-16-20UG | 20UG |
| Human gAcrp30/Adipolean Variant | 450-20-25UG | 25UG |
| Human gAcrp30/Adipolean | 450-21-500UG | 500UG |
| Human Adiponectin | 450-24-5UG | 5UG |
| Human Adiponectin | 450-24-1mg | 1MG |
| Human Adiponectin | 450-24-100UG | 100UG |
| Murine RELMbeta | 450-26B-1MG | 1MG |
| Murine RELMgamma | 450-26G-100UG | 100UG |
| Murine Resistin | 450-28-250UG | 250UG |
| Murine FGF-basic | 450-33-50UG | 50UG |
| Human/Rat Neuritin | 450-36D-20UG | 20UG |
| Human/Rat Neuritin | 450-36D-1MG | 1MG |
| Human Galectin-3 | 450-38-1MG | 1MG |
| Human Galectin-1 | 450-39-250UG | 250UG |
| Murine Artemin | 450-58-100UG | 100UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04-50UG | 50UG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10GBt-1MG | 1MG |
| Anti-Human IGF-I | 500-P11-1MG | 1MG |
| Biotinylated Anti-Human IGF-II | 500-P12Bt-50UG | 50UG |
| Anti-Human FGF-acidic | 500-P17-100UG | 100UG |
| Biotinylated Anti-Human KGF (FGF-7) | 500-P19Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-1alpha | 500-P21ABt-25UG | 25UG |
| Anti-Human IL-1beta | 500-P21BG-100UG | 100UG |
| Biotinylated Anti-Human IL-2 (Polyclonal Goat) | 500-P22GBt-1MG | 1MG |
| Biotinylated Anti-Human sIL-2 Receptor alpha | 500-P22RBt-25UG | 25UG |
| Biotinylated Anti-Human IL-3 | 500-P23Bt-1MG | 1MG |
| Anti-Human IL-6 (Polyclonal Goat) | 500-P26G-100UG | 100UG |
| Biotinylated Anti-Human IL-9 | 500-P29Bt-50UG | 50UG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AGBt-25UG | 25UG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AGBt-1MG | 1MG |
| Biotinylated Anti-Human TNF-beta | 500-P31BBt-25UG | 25UG |
| Biotinylated Anti-Human IFN-beta | 500-P32BBt-50UG | 50UG |
| Biotinylated Anti-Human MCP-1 (CCL2) | 500-P34Bt-1MG | 1MG |
| Anti-Human MCP-2 (CCL8) | 500-P35-100UG | 100UG |
| Anti-Human MCP-3 (CCL7) | 500-P37G-100UG | 100UG |
| Anti-Human MIP-1beta (CCL4) | 500-P38B-50UG | 50UG |
| Biotinylated Anti-Human LIF | 500-P39Bt-1MG | 1MG |
| Biotinylated Anti-Human Eotaxin (CCL11) (Polyclonal Goat) | 500-P41GBt-50UG | 50UG |
| Biotinylated Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41Bt-50UG | 50UG |
| Anti-Human Flt3-Ligand | 500-P42-1MG | 1MG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41-100UG | 100UG |
| Anti-Human PDGF-AA | 500-P46-50UG | 50UG |
| Biotinylated Anti-Human PDGF-AA | 500-P46Bt-1MG | 1MG |
| Biotinylated Anti-Human PDGF-AA | 500-P46Bt-25UG | 25UG |
| Biotinylated Anti-Human SCF (Polyclonal Rabbit) | 500-P48Bt-1MG | 1MG |
| Anti-Human TPO (Polyclonal Rabbit) | 500-P49-50UG | 50UG |
| Biotinylated Anti-Human SCF (Polyclonal Goat) | 500-P48GBt-1MG | 1MG |
| Anti-Human TPO (Polyclonal Goat) | 500-P49G-100UG | 100UG |
| Murine GM-CSF | AF-315-03-250UG | 250UG |
| Murine LIGHT | AF-315-12-250UG | 250UG |
| Rat IL-2 | AF-400-02-500UG | 500UG |
| Rat SCF | AF-400-22-10UG | 10UG |
| Rat GM-CSF | AF-400-23-100UG | 100UG |
| Rat GM-CSF | AF-400-23-1MG | 1MG |
| Rat GM-CSF | AF-400-23-5UG | 5UG |
| Human NT-4 | AF-450-04-500UG | 500UG |
| Human Artemin | AF-450-17-250UG | 250UG |
| Murine Leptin | AF-450-31-5MG | 5MG |
| Normal Rabbit Immunoglobulin | 500-P00-500UG | 500UG |
| Anti-Human sIL-2 Receptor alpha (Monoclonal Mouse) | 500-M02R-500UG | 500UG |
| Anti-Human IL-8 (CXCL8) (Monoclonal Mouse) | 500-M08-500UG | 500UG |
| Anti-Human G-CSF (Monoclonal Mouse) | 500-M37-500UG | 500UG |
| Anti-Human BAFF (Monoclonal Mouse) | 500-M64-500UG | 500UG |
| Anti-Human RANTES (CCL5) (Monoclonal Mouse) | 500-M75-500UG | 500UG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03-100UG | 100UG |
| Anti-Human IL-16 | 500-P06-100UG | 100UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Goat) | 500-P07GBt-1MG | 1MG |
| Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10G-50UG | 50UG |
| Anti-Human IGF-I | 500-P11-100UG | 100UG |
| Biotinylated Anti-Human IL-1alpha | 500-P21ABt-1MG | 1MG |
| Anti-Human IL-1beta | 500-P21BG-1MG | 1MG |
| Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22-1MG | 1MG |
| Biotinylated Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-5 | 500-P25Bt-1MG | 1MG |
| Anti-Human IL-6 (Polyclonal Rabbit) | 500-P26-100UG | 100UG |
| Biotinylated Anti-Human IL-6 (Polyclonal Rabbit) | 500-P26Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-6 (Polyclonal Goat) | 500-P26GBt-1MG | 1MG |
| Biotinylated Anti-Human Oncostatin M | 500-P30Bt-25UG | 25UG |
| Biotinylated Anti-Human Oncostatin M | 500-P30Bt-1MG | 1MG |
| Anti-Human IFN-gamma | 500-P32-1MG | 1MG |
| Anti-Human IFN-beta | 500-P32B-50UG | 50UG |
| Anti-Human MCP-1 (CCL2) | 500-P34-100UG | 100UG |
| Biotinylated Anti-Human MCP-2 (CCL8) | 500-P35Bt-50UG | 50UG |
| Biotinylated Anti-Human MIP-1beta (CCL4) | 500-P38BBt-25UG | 25UG |
| Biotinylated Anti-Human MIP-1alpha (CCL3) (Polyclonal Rabbit) | 500-P38Bt-25UG | 25UG |
| Anti-Human Lymphotactin (XCL1) | 500-P40-50UG | 50UG |
| Biotinylated Anti-Human Lymphotactin (XCL1) | 500-P40Bt-50UG | 50UG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Goat) | 500-P41G-50UG | 50UG |
| Biotinylated Anti-Human G-CSF | 500-P43Bt-25UG | 25UG |
| Anti-Human PDGF-BB | 500-P47-100UG | 100UG |
| Anti-Human SCF (Polyclonal Goat) | 500-P48G-100UG | 100UG |
| Murine GM-CSF | AF-315-03-100UG | 100UG |
| Murine LIGHT | AF-315-12-500UG | 500UG |
| Murine TPO | AF-315-14-250UG | 250UG |
| Rat GM-CSF | AF-400-23-250UG | 250UG |
| Rat M-CSF | AF-400-28-100UG | 100UG |
| Human Artemin | AF-450-17-500UG | 500UG |
| Normal Mouse Immunoglobulin | 500-M00-1MG | 1MG |
| Anti-Human IL-11 (Monoclonal Mouse) | 500-M11-500UG | 500UG |
| Anti-Human MIP-3alpha (CCL20) (Monoclonal Mouse) | 500-M28-500UG | 500UG |
| Biotinylated Anti-Human IL-11 | 500-P01Bt-50UG | 50UG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04Bt-25UG | 25UG |
| Biotinylated Anti-Human PF-4 (CXCL4) | 500-P05Bt-25UG | 25UG |
| Anti-Human IL-16 | 500-P06-1MG | 1MG |
| Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07-50UG | 50UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Goat) | 500-P07GBt-25UG | 25UG |
| Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10-50UG | 50UG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10Bt-50UG | 50UG |
| Anti-Human TGF-alpha | 500-P16-100UG | 100UG |
| Anti-Human KGF (FGF-7) | 500-P19-1MG | 1MG |
| Anti-Human IL-1beta | 500-P21BG-50UG | 50UG |
| Biotinylated Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-2 (Polyclonal Goat) | 500-P22GBt-25UG | 25UG |
| Anti-Human sIL-2 Receptor alpha | 500-P22R-1MG | 1MG |
| Biotinylated Anti-Human IL-3 | 500-P23Bt-25UG | 25UG |
| Human TL-1A | AF-310-23-500UG | 500UG |
| Murine TNF-alpha | AF-315-01A-50UG | 50UG |
| Murine TNF-alpha | AF-315-01A-250UG | 250UG |
| Murine TNF-alpha | AF-315-01A-1MG | 1MG |
| Murine M-CSF | AF-315-02-1MG | 1MG |
| Rat IL-2 | AF-400-02-100UG | 100UG |
| Rat GM-CSF | AF-400-23-500UG | 500UG |
| Rat TPO | AF-400-34-10UG | 10UG |
| Rat M-CSF | AF-400-28-500UG | 500UG |
| Murine Leptin | AF-450-31-1MG | 1MG |
| Human Enterokinase | AF-450-48C-1MG | 1MG |
| Normal Goat Immunoglobulin | 500-G00-1MG | 1MG |
| Anti-Human IL-2 (Monoclonal Mouse) | 500-M02-500UG | 500UG |
| Anti-Human Eotaxin-2 (CCL24) (Monoclonal Mouse) | 500-M31-500UG | 500UG |
| Anti-Human IP-10 (CXCL10) (Monoclonal Mouse) | 500-M60-500UG | 500UG |
| Anti-Human BMP-7 (Monoclonal Mouse) | 500-M123-500UG | 500UG |
| Anti-Rat IL-2 (Monoclonal Mouse) | 500-M129-500UG | 500UG |
| Anti-Human IL-11 | 500-P01-50UG | 50UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04-1MG | 1MG |
| Anti-Human PF-4 (CXCL4) | 500-P05-1MG | 1MG |
| Anti-Human IL-16 | 500-P06-50UG | 50UG |
| Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07-1MG | 1MG |
| Anti-Human IL-17A (Polyclonal Goat) | 500-P07G-100UG | 100UG |
| Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10-1MG | 1MG |
| Anti-Human IL-13 | 500-P13-100UG | 100UG |
| Biotinylated Anti-Human TGF-alpha | 500-P16Bt-50UG | 50UG |
| Anti-Human FGF-acidic | 500-P17-1MG | 1MG |
| Biotinylated Anti-Human IL-1alpha | 500-P21ABt-50UG | 50UG |
| Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22-50UG | 50UG |
| Anti-Human IL-2 (Polyclonal Goat) | 500-P22G-1MG | 1MG |
| Anti-Human sIL-2 Receptor alpha | 500-P22R-50UG | 50UG |
| Biotinylated Anti-Human IL-4 | 500-P24Bt-50UG | 50UG |
| Anti-Human IL-4 | 500-P24-50UG | 50UG |
| Anti-Human IL-9 | 500-P29-100UG | 100UG |
| Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AG-1MG | 1MG |
| Anti-Human IFN-gamma | 500-P32-50UG | 50UG |
| Biotinylated Anti-Human GM-CSF | 500-P33Bt-1MG | 1MG |
| Anti-Human MCP-1 (CCL2) | 500-P34-1MG | 1MG |
| Anti-Human MCP-3 (CCL7) | 500-P37G-1MG | 1MG |
| Anti-Human MIP-1alpha (CCL3) (Polyclonal Rabbit) | 500-P38-50UG | 50UG |
| Anti-Human LIF | 500-P39-50UG | 50UG |
| Biotinylated Anti-Human LIF | 500-P39Bt-50UG | 50UG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Goat) | 500-P41G-100UG | 100UG |
| Biotinylated Anti-Human SCF (Polyclonal Rabbit) | 500-P48Bt-25UG | 25UG |
| Anti-Human SCF (Polyclonal Goat) | 500-P48G-50UG | 50UG |
| Anti-Human TPO (Polyclonal Rabbit) | 500-P49-1MG | 1MG |
| Murine M-CSF | AF-315-02-250UG | 250UG |
| Murine IFN-gamma | AF-315-05-500UG | 500UG |
| Rat IL-2 | AF-400-02-250UG | 250UG |
| Rat GM-CSF | AF-400-23-20UG | 20UG |
| Human NT-4 | AF-450-04-2UG | 2UG |
| Human Artemin | AF-450-17-5UG | 5UG |
| Anti-Human IL-1beta (Monoclonal Mouse) | 500-M01B-500UG | 500UG |
| Anti-Human NT-4 (Monoclonal Mouse) | 500-M24-500UG | 500UG |
| Anti-Human IL-6 (Monoclonal Mouse) | 500-M06-500UG | 500UG |
| Anti-Human FGF-basic (Monoclonal Mouse) | 500-M38-500UG | 500UG |
| Anti-Human sRANK Ligand (Monoclonal Mouse) | 500-M46-500UG | 500UG |
| Anti-Human Resistin (Monoclonal Mouse) | 500-M91-500UG | 500UG |
| Anti-Murine IL-2 (Monoclonal Rat) | 500-M127-500UG | 500UG |
| Anti-Human IL-11 | 500-P01-1MG | 1MG |
| Anti-Rat IL-10 (Monoclonal Mouse) | 500-M130-500UG | 500UG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03G-100UG | 100UG |
| Anti-Human Fractalkine (CX3CL1) | 500-P98-100UG | 100UG |
| Anti-Human Cardiotrophin-1 | 500-P101-100UG | 100UG |
| Biotinylated Anti-Human Neurturin | 500-P102Bt-50UG | 50UG |
| Anti-Human Eotaxin-2 (CCL24) | 500-P103G-100UG | 100UG |
| Anti-Human HCC-1 (CCL14) | 500-P106-100UG | 100UG |
| Biotinylated Anti-Human MDC (CCL22) | 500-P107Bt-25UG | 25UG |
| Anti-Human I-309 (CCL1) | 500-P110-50UG | 50UG |
| Biotinylated Anti-Human I-309 (CCL1) | 500-P110Bt-50UG | 50UG |
| Biotinylated Anti-Murine KC (CXCL1) | 500-P115Bt-50UG | 50UG |
| Biotinylated Anti-Murine RANTES (CCL5) | 500-P118Bt-25UG | 25UG |
| Biotinylated Anti-Murine IFN-gamma | 500-P119Bt-25UG | 25UG |
| Biotinylated Anti-Murine RANTES (CCL5) | 500-P118Bt-1MG | 1MG |
| Anti-Human NP-1 | 500-P126G-1MG | 1MG |
| Biotinylated Anti-Murine IP-10 (CXCL10) | 500-P129Bt-1MG | 1MG |
| Biotinylated Anti-Human I-TAC (CXCL11) | 500-P132Bt-50UG | 50UG |
| Anti-Human I-TAC (CXCL11) | 500-P132-1MG | 1MG |
| Anti-Human TECK (CCL25) | 500-P134-50UG | 50UG |
| Biotinylated Anti-Human sCD40 Ligand | 500-P142GBt-1MG | 1MG |
| Biotinylated Anti-Human sRANK Receptor | 500-P144Bt-50UG | 50UG |
| Anti-Human FGF-17 (Polyclonal Rabbit) | 500-P152-50UG | 50UG |
| Biotinylated Anti-Human TPO (Polyclonal Rabbit) | 500-P49Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-3 | 500-P53Bt-25UG | 25UG |
| Anti-Murine IL-4 | 500-P54-100UG | 100UG |
| Biotinylated Anti-Murine IL-10 | 500-P60Bt-1MG | 1MG |
| Anti-Murine M-CSF | 500-P62G-1MG | 1MG |
| Biotinylated Anti-Murine TNF-alpha (Polyclonal Rabbit) | 500-P64Bt-25UG | 25UG |
| Anti-Murine GM-CSF | 500-P65-50UG | 50UG |
| Biotinylated Anti-Murine GM-CSF | 500-P65Bt-50UG | 50UG |
| Anti-Murine Eotaxin (CCL11) | 500-P67-1MG | 1MG |
| Biotinylated Anti-Murine Leptin | 500-P68Bt-50UG | 50UG |
| Biotinylated Anti-Murine Eotaxin (CCL11) | 500-P67Bt-25UG | 25UG |
| Anti-Murine G-CSF | 500-P69-1MG | 1MG |
| Anti-Rat GRO/KC (CXCL1) | 500-P74-50UG | 50UG |
| Biotinylated Anti-Rat RANTES (CCL5) | 500-P78Bt-50UG | 50UG |
| Biotinylated Anti-Rat MIP-1alpha (CCL3) | 500-P77Bt-1MG | 1MG |
| Anti-Rat CNTF | 500-P79-1MG | 1MG |
| Biotinylated Anti-Human GDNF | 500-P81Bt-1MG | 1MG |
| Anti-Human beta-NGF | 500-P85-50UG | 50UG |
| Anti-Human beta-NGF | 500-P85-1MG | 1MG |
| Anti-Human SDF-1alpha (CXCL12) | 500-P87A-50UG | 50UG |
| Anti-Human SDF-1beta (CXCL12) | 500-P87BG-50UG | 50UG |
| Biotinylated Anti-Human IL-17E | 500-P89Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-17F | 500-P90Bt-50UG | 50UG |
| Biotinylated Anti-Human IP-10 (CXCL10) | 500-P93Bt-25UG | 25UG |
| Biotinylated Anti-Rat IL-4 | 500-P94Bt-1MG | 1MG |
| Biotinylated Anti-Human MIP-3alpha (CCL20) | 500-P95ABt-50UG | 50UG |
| Anti-Human TARC (CCL17) | 500-P97-50UG | 50UG |
| Anti-Human Eotaxin-2 (CCL24) | 500-P103G-50UG | 50UG |
| Biotinylated Anti-Human GRO-gamma (CXCL3) | 500-P105Bt-25UG | 25UG |
| Anti-Human GRO-gamma (CXCL3) | 500-P105-100UG | 100UG |
| Anti-Human MDC (CCL22) | 500-P107-1MG | 1MG |
| Anti-Human MIP-4 (CCL18) | 500-P108-100UG | 100UG |
| Biotinylated Anti-Human Exodus-2 (CCL21) | 500-P109Bt-25UG | 25UG |
| Biotinylated Anti-Human I-309 (CCL1) | 500-P110Bt-25UG | 25UG |
| Biotinylated Anti-Murine C10 (CCL6) | 500-P112Bt-25UG | 25UG |
| Biotinylated Anti-Murine JE/MCP-1 (CCL2) | 500-P113Bt-50UG | 50UG |
| Anti-Murine MCP-3 (CCL7) | 500-P116G-1MG | 1MG |
| Anti-Murine MIP-1gamma (CCL9/10) | 500-P117-50UG | 50UG |
| Biotinylated Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122GBt-50UG | 50UG |
| Anti-Human MIP-5 (CCL15) | 500-P123G-100UG | 100UG |
| Anti-Human MIP-3 (CCL23) | 500-P124-1MG | 1MG |
| Anti-Human LEC (CCL16) | 500-P125G-50UG | 50UG |
| Biotinylated Anti-Murine IP-10 (CXCL10) | 500-P129Bt-50UG | 50UG |
| Anti-Murine MIP-2 (CXCL2) | 500-P130-1MG | 1MG |
| Biotinylated Anti-Human I-TAC (CXCL11) | 500-P132Bt-25UG | 25UG |
| Anti-Human TECK (CCL25) | 500-P134-100UG | 100UG |
| Anti-Human sTRAIL/Apo2L | 500-P135-50UG | 50UG |
| Anti-Human CNTF | 500-P140-50UG | 50UG |
| Biotinylated Anti-Human CNTF | 500-P140Bt-25UG | 25UG |
| Biotinylated Anti-Human sCD40 Ligand | 500-P142GBt-50UG | 50UG |
| Anti-Human sTNF Receptor Type I | 500-P143-1MG | 1MG |
| Biotinylated Anti-Human sTNF Receptor Type I | 500-P143Bt-25UG | 25UG |
| Anti-Human OPG | 500-P149-50UG | 50UG |
| Biotinylated Anti-Murine LIX (CXCL6) | 500-P146Bt-25UG | 25UG |
| Anti-Human FGF-10 | 500-P151G-1MG | 1MG |
| Anti-Human MIG (CXCL9) | 500-P50-100UG | 100UG |
| Biotinylated Anti-Murine IL-1beta | 500-P51Bt-50UG | 50UG |
| Anti-Murine IL-3 | 500-P53-1MG | 1MG |
| Anti-Murine IL-1alpha | 500-P51A-1MG | 1MG |
| Biotinylated Anti-Murine IL-7 | 500-P57Bt-1MG | 1MG |
| Anti-Murine IL-7 | 500-P57-100UG | 100UG |
| Anti-Murine IL-7 | 500-P57-50UG | 50UG |
| Anti-Murine IL-10 | 500-P60-50UG | 50UG |
| Anti-Murine GM-CSF | 500-P65-100UG | 100UG |
| Biotinylated Anti-Murine GM-CSF | 500-P65Bt-1MG | 1MG |
| Biotinylated Anti-Murine G-CSF | 500-P69Bt-1MG | 1MG |
| Anti-Rat IL-6 (Polyclonal Rabbit) | 500-P73-1MG | 1MG |
| Biotinylated Anti-Rat IL-6 (Polyclonal Goat) | 500-P73GBt-25UG | 25UG |
| Anti-Rat GRO/KC (CXCL1) | 500-P74-1MG | 1MG |
| Anti-Rat GRO-beta/MIP-2 (CXCL2) | 500-P75-50UG | 50UG |
| Anti-Rat RANTES (CCL5) | 500-P78-1MG | 1MG |
| Biotinylated Anti-Human GDNF | 500-P81Bt-50UG | 50UG |
| Anti-Human NT-3 (Polyclonal Goat) | 500-P82G-50UG | 50UG |
| Biotinylated Anti-Human NT-3 (Polyclonal Goat) | 500-P82GBt-1MG | 1MG |
| Biotinylated Anti-Human NT-4 | 500-P83GBt-50UG | 50UG |
| Anti-Human beta-NGF | 500-P85-100UG | 100UG |
| Biotinylated Anti-Human/Murine/Rat BDNF | 500-P84Bt-50UG | 50UG |
| Anti-Human SDF-1alpha (CXCL12) | 500-P87A-1MG | 1MG |
| Anti-Human IL-17D | 500-P88-1MG | 1MG |
| Biotinylated Anti-Human IL-17E | 500-P89Bt-1MG | 1MG |
| Anti-Human Leptin | 500-P86-100UG | 100UG |
| Anti-Human IL-17D | 500-P88-100UG | 100UG |
| Anti-Human ENA-78 (CXCL5) | 500-P91-100UG | 100UG |
| Biotinylated Anti-Human MIP-3beta (CCL19) | 500-P95BBt-1MG | 1MG |
| Biotinylated Anti-Rat IL-4 | 500-P94Bt-50UG | 50UG |
| Anti-Human TARC (CCL17) | 500-P97-100UG | 100UG |
| Biotinylated Anti-Human Fractalkine (CX3CL1) | 500-P98Bt-50UG | 50UG |
| Anti-Human Neurturin | 500-P102-1MG | 1MG |
| Anti-Human GRO-beta (CXCL2) | 500-P104-100UG | 100UG |
| Biotinylated Anti-Human GRO-gamma (CXCL3) | 500-P105Bt-50UG | 50UG |
| Anti-Human HCC-1 (CCL14) | 500-P106-1MG | 1MG |
| Anti-Human MDC (CCL22) | 500-P107-100UG | 100UG |
| Anti-Human Exodus-2 (CCL21) | 500-P109-1MG | 1MG |
| Biotinylated Anti-Human I-309 (CCL1) | 500-P110Bt-1MG | 1MG |
| Anti-Murine JE/MCP-1 (CCL2) | 500-P113-50UG | 50UG |
| Anti-Murine KC (CXCL1) | 500-P115-1MG | 1MG |
| Anti-Murine MCP-3 (CCL7) | 500-P116G-100UG | 100UG |
| Biotinylated Anti-Murine MCP-3 (CCL7) | 500-P116GBt-1MG | 1MG |
| Anti-Murine RANTES (CCL5) | 500-P118-1MG | 1MG |
| Biotinylated Anti-Human IGF-I | 500-P11Bt-50UG | 50UG |
| Anti-Rat IFN-gamma (Polyclonal Rabbit) | 500-P122-100UG | 100UG |
| Anti-Human I-TAC (CXCL11) | 500-P132-100UG | 100UG |
| Biotinylated Anti-Human sRANK Ligand (Polyclonal Rabbit) | 500-P133Bt-50UG | 50UG |
| Anti-Human TECK (CCL25) | 500-P134-1MG | 1MG |
| Biotinylated Anti-Human sRANK Ligand (Polyclonal Goat) | 500-P133GBt-1MG | 1MG |
| Anti-Human TWEAK | 500-P137G-1MG | 1MG |
| Biotinylated Anti-Human sTRAIL/Apo2L | 500-P135Bt-1MG | 1MG |
| Biotinylated Anti-Human TWEAK | 500-P137GBt-25UG | 25UG |
| Anti-Rat IL-10 | 500-P139-1MG | 1MG |
| Anti-Human BCA-1 (CXCL13) | 500-P141-50UG | 50UG |
| Biotinylated Anti-Human BCA-1 (CXCL13) | 500-P141Bt-50UG | 50UG |
| Anti-Human sCD40 Ligand | 500-P142G-1MG | 1MG |
| Anti-Murine LIX (CXCL6) | 500-P146-50UG | 50UG |
| Anti-Human OPG | 500-P149-100UG | 100UG |
| Biotinylated Anti-Human OPG | 500-P149Bt-25UG | 25UG |
| Biotinylated Anti-Human OPG | 500-P149Bt-1MG | 1MG |
| Biotinylated Anti-Human MIG (CXCL9) | 500-P50Bt-50UG | 50UG |
| Biotinylated Anti-Murine IL-1alpha | 500-P51ABt-25UG | 25UG |
| Biotinylated Anti-Murine IL-5 | 500-P55Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-5 | 500-P55Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-9 | 500-P59Bt-1MG | 1MG |
| Biotinylated Anti-Murine M-CSF | 500-P62GBt-25UG | 25UG |
| Anti-Murine sRANK Ligand | 500-P63-1MG | 1MG |
| Biotinylated Anti-Murine sRANK Ligand | 500-P63Bt-1MG | 1MG |
| Biotinylated Anti-Murine TNF-alpha (Polyclonal Goat) | 500-P64GBt-1MG | 1MG |
| Biotinylated Anti-Murine FGF-9 | 500-P66Bt-1MG | 1MG |
| Anti-Murine Leptin | 500-P68-100UG | 100UG |
| Biotinylated Anti-Murine Leptin | 500-P68Bt-1MG | 1MG |
| Biotinylated Anti-Murine G-CSF | 500-P69Bt-50UG | 50UG |
| Biotinylated Anti-Rat TNF-alpha | 500-P72Bt-50UG | 50UG |
| Biotinylated Anti-Rat MCP-1 (CCL2) | 500-P76Bt-1MG | 1MG |
| Biotinylated Anti-Rat RANTES (CCL5) | 500-P78Bt-1MG | 1MG |
| Anti-Rat IL-1beta | 500-P80-100UG | 100UG |
| Biotinylated Anti-Human NT-3 (Polyclonal Rabbit) | 500-P82Bt-1MG | 1MG |
| Biotinylated Anti-Human beta-NGF | 500-P85Bt-25UG | 25UG |
| Biotinylated Anti-Human Leptin | 500-P86Bt-1MG | 1MG |
| Biotinylated Anti-Human SDF-1beta (CXCL12) | 500-P87BGBt-25UG | 25UG |
| Biotinylated Anti-Human IL-17F | 500-P90Bt-1MG | 1MG |
| Anti-Human IP-10 (CXCL10) | 500-P93-100UG | 100UG |
| Anti-Rat IL-4 | 500-P94-100UG | 100UG |
| Biotinylated Anti-Human MIP-3beta (CCL19) | 500-P95BBt-25UG | 25UG |
| Biotinylated Anti-Human TARC (CCL17) | 500-P97Bt-25UG | 25UG |
| Biotinylated Anti-Human BAFF (Polyclonal Rabbit) | 500-P163BT-1MG | 1MG |
| Biotinylated Anti-Human BAFF (Polyclonal Goat) | 500-P163GBt-25UG | 25UG |
| Biotinylated Anti-Murine IL-15 | 500-P173Bt-25UG | 25UG |
| Biotinylated Anti-Murine EGF | 500-P174GBt-1MG | 1MG |
| Biotinylated Anti-Murine Eotaxin-2 (CCL24) | 500-P175GBt-25UG | 25UG |
| Biotinylated Anti-Murine MDC (CCL22) | 500-P176Bt-1MG | 1MG |
| Biotinylated Anti-Rat IL-3beta | 500-P177GBt-25UG | 25UG |
| Anti-Human LIGHT | 500-P179-1MG | 1MG |
| Anti-Rat IL-1alpha | 500-P180G-50UG | 50UG |
| Biotinylated Anti-Human FGF-acidic | 500-P17Bt-25UG | 25UG |
| Anti-Human sFas Ligand | 500-P184G-50UG | 50UG |
| Anti-Rat Leptin | 500-P185G-50UG | 50UG |
| Biotinylated Anti-Human NNT-1/BCSF-3 | 500-P186Bt-50UG | 50UG |
| Anti-Human IL-19 | 500-P189-50UG | 50UG |
| Anti-Human IL-20 | 500-P190G-50UG | 50UG |
| Biotinylated Anti-Human IL-20 | 500-P190GBt-50UG | 50UG |
| Anti-Human APRIL | 500-P192-100UG | 100UG |
| Anti-Human gAcrp30/Adipolean | 500-P193G-100UG | 100UG |
| Biotinylated Anti-Human gAcrp30/Adipolean | 500-P193GBt-1MG | 1MG |
| Biotinylated Anti-Human BMP-7 | 500-P198Bt-1MG | 1MG |
| Anti-Murine RELMbeta | 500-P215-50UG | 50UG |
| Anti-Human Visfatin | 500-P222-100UG | 100UG |
| Biotinylated Anti-Human Visfatin | 500-P222Bt-25UG | 25UG |
| Anti-Human PlGF-1 | 500-P226-50UG | 50UG |
| Biotinylated Anti-Human IGF-BP1 | 500-P228Bt-25UG | 25UG |
| Anti-Human IGF-BP7 | 500-P234-50UG | 50UG |
| Biotinylated Anti-Human IGF-BP7 | 500-P234Bt-50UG | 50UG |
| Biotinylated Anti-Human Nanog | 500-P236Bt-50UG | 50UG |
| Biotinylated Anti-Human TL-1A | 500-P240Bt-50UG | 50UG |
| Anti-Human MIA | 500-P243-1MG | 1MG |
| Anti-Human AITRL | 500-P244-50UG | 50UG |
| Anti-Human AITRL | 500-P244-100UG | 100UG |
| Anti-Human Galectin-3 | 500-P246-1MG | 1MG |
| Anti-Human IFN-lambda2 | 500-P247-1MG | 1MG |
| Biotinylated Anti-Human IL-31 | 500-P249Bt-1MG | 1MG |
| Biotinylated Anti-Human CTGF | 500-P252Bt-50UG | 50UG |
| Anti-Human Betacellulin | 500-P254-100UG | 100UG |
| Anti-Human FGF-4 | 500-P158-100UG | 100UG |
| Biotinylated Anti-Human IL-15 | 500-P15Bt-50UG | 50UG |
| Biotinylated Anti-Human FGF-16 | 500-P160GBt-25UG | 25UG |
| Biotinylated Anti-Murine SDF-1alpha (CXCL12) | 500-P164GBt-1MG | 1MG |
| Anti-Human 4-1BB Receptor | 500-P167G-100UG | 100UG |
| Biotinylated Anti-Human 4-1BB Receptor | 500-P167GBt-1MG | 1MG |
| Anti-Human Midkine | 500-P171-100UG | 100UG |
| Anti-Murine MDC (CCL22) | 500-P176-50UG | 50UG |
| Anti-Human LIGHT | 500-P179-100UG | 100UG |
| Anti-Rat IL-1alpha | 500-P180G-1MG | 1MG |
| Biotinylated Anti-Rat IL-1alpha | 500-P180GBt-1MG | 1MG |
| Biotinylated Anti-Murine Resistin | 500-P182GBt-25UG | 25UG |
| Biotinylated Anti-Murine Resistin | 500-P182GBt-1MG | 1MG |
| Biotinylated Anti-Human sFas Ligand | 500-P184GBt-25UG | 25UG |
| Anti-Human NNT-1/BCSF-3 | 500-P186-50UG | 50UG |
| Anti-Human NNT-1/BCSF-3 | 500-P186-100UG | 100UG |
| Anti-Human EG-VEGF | 500-P188G-100UG | 100UG |
| Biotinylated Anti-Human EG-VEGF | 500-P188GBt-1MG | 1MG |
| Anti-Human APRIL | 500-P192-50UG | 50UG |
| Biotinylated Anti-Human/Murine/Rat BMP-2 | 500-P195Bt-50UG | 50UG |
| Anti-Human BMP-7 | 500-P198-50UG | 50UG |
| Anti-Human BMP-7 | 500-P198-1MG | 1MG |
| Biotinylated Anti-Murine CXCL16 | 500-P201GBt-50UG | 50UG |
| Biotinylated Anti-Rat SCF | 500-P202Bt-25UG | 25UG |
| Anti-Human Follistatin | 500-P207-1MG | 1MG |
| Anti-Human Galectin-1 | 500-P210-100UG | 100UG |
| Anti-Human CTGFL/WISP-2 | 500-P212-1MG | 1MG |
| Anti-Murine RELMalpha | 500-P214-100UG | 100UG |
| Biotinylated Anti-Human Visfatin | 500-P222Bt-1MG | 1MG |
| Anti-Human sCD22 | 500-P227-100UG | 100UG |
| Anti-Human IGF-BP1 | 500-P228-100UG | 100UG |
| Anti-Human IGF-BP5 | 500-P232-100UG | 100UG |
| Biotinylated Anti-Human GDF-3 | 500-P235Bt-1MG | 1MG |
| Anti-Human Nanog | 500-P236-1MG | 1MG |
| Biotinylated Anti-Human BRAK (CXCL14) | 500-P237Bt-50UG | 50UG |
| Anti-Human CRP | 500-P242-100UG | 100UG |
| Biotinylated Anti-Human MIA | 500-P243Bt-1MG | 1MG |
| Anti-Human IL-17B | 500-P248-100UG | 100UG |
| Anti-Human IFN-lambda2 | 500-P247-100UG | 100UG |
| Biotinylated Anti-Human IFN-lambda2 | 500-P247Bt-50UG | 50UG |
| Biotinylated Anti-Human Wnt-1 | 500-P250Bt-1MG | 1MG |
| Anti-Human CTGF | 500-P252-1MG | 1MG |
| Anti-Human Vaspin | 500-P256-100UG | 100UG |
| Anti-Human Vaspin | 500-P256-50UG | 50UG |
| Biotinylated Anti-Human NOV | 500-P257Bt-50UG | 50UG |
| Biotinylated Anti-Human TSLP | 500-P258Bt-50UG | 50UG |
| Biotinylated Anti-Murine SF-20 | 500-P259Bt-25UG | 25UG |
| Anti-Human PAI-1 | 500-P260-100UG | 100UG |
| Anti-Human BD-4 | 500-P268-50UG | 50UG |
| Biotinylated Anti-Human BD-4 | 500-P268Bt-1MG | 1MG |
| Biotinylated Anti-Human Neuroserpin | 500-P271Bt-25UG | 25UG |
| Biotinylated Anti-Human Neuroserpin | 500-P271Bt-50UG | 50UG |
| Anti-Murine IL-21 | 500-P278-1MG | 1MG |
| Biotinylated Anti-Human sDLL-4 | 500-P279Bt-25UG | 25UG |
| Biotinylated Anti-Human CTACK (CCL27) | 500-P294Bt-50UG | 50UG |
| Anti-Human MEC (CCL28) | 500-P297-50UG | 50UG |
| Anti-Human VCAM-1 | 500-P300-50UG | 50UG |
| Anti-Murine TRAIL | 500-P303-50UG | 50UG |
| Biotinylated Anti-Human EGF Receptor (EGFR) | 500-P306Bt-50UG | 50UG |
| Anti-Murine LIGHT | 500-P308-1MG | 1MG |
| Biotinylated Anti-Human Osteopontin | 500-P314Bt-1MG | 1MG |
| Biotinylated Anti-Rat SDF-1alpha (CXCL12) | 500-P315Bt-1MG | 1MG |
| Biotinylated Anti-Human EPO | 500-P318Bt-50UG | 50UG |
| Biotinylated Anti-Human Galectin-1 | 500-P210Bt-1MG | 1MG |
| Anti-Human IL-22 | 500-P211-1MG | 1MG |
| Biotinylated Anti-Human CTGFL/WISP-2 | 500-P212Bt-50UG | 50UG |
| Anti-Murine MIP-1beta (CCL4) | 500-P213-1MG | 1MG |
| Biotinylated Anti-Murine RELMbeta | 500-P215Bt-25UG | 25UG |
| Biotinylated Anti-Human PlGF-1 | 500-P226Bt-50UG | 50UG |
| Anti-Human sCD22 | 500-P227-50UG | 50UG |
| Biotinylated Anti-Human sCD22 | 500-P227Bt-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP3 | 500-P230Bt-50UG | 50UG |
| Anti-Human ApoE3 | 500-P238-50UG | 50UG |
| Anti-Human BD-3 | 500-P241-1MG | 1MG |
| Biotinylated Anti-Human AITRL | 500-P244Bt-50UG | 50UG |
| Anti-Human Wnt-1 | 500-P250-1MG | 1MG |
| Biotinylated Anti-Human Wnt-1 | 500-P250Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-18BP | 500-P153GBt-1MG | 1MG |
| Anti-Murine IL-12 | 500-P155G-100UG | 100UG |
| Anti-Murine IGF-I | 500-P157G-100UG | 100UG |
| Biotinylated Anti-Human FGF-16 | 500-P160GBt-1MG | 1MG |
| Anti-Human SCGF-alpha | 500-P162-50UG | 50UG |
| Anti-Human TACI | 500-P166G-1MG | 1MG |
| Biotinylated Anti-Human 4-1BB Receptor | 500-P167GBt-25UG | 25UG |
| Biotinylated Anti-Human sTNF Receptor Type II | 500-P168Bt-1MG | 1MG |
| Anti-Human Midkine | 500-P171-50UG | 50UG |
| Biotinylated Anti-Human EMAP-II | 500-P172GBt-1MG | 1MG |
| Anti-Murine IL-15 | 500-P173-100UG | 100UG |
| Biotinylated Anti-Murine IL-15 | 500-P173Bt-1MG | 1MG |
| Biotinylated Anti-Murine Eotaxin-2 (CCL24) | 500-P175GBt-1MG | 1MG |
| Biotinylated Anti-Rat Leptin | 500-P185GBt-1MG | 1MG |
| Anti-Human LD78beta (CCL3L1) | 500-P187G-1MG | 1MG |
| Anti-Human IL-20 | 500-P190G-1MG | 1MG |
| Anti-Human IL-21 | 500-P191-50UG | 50UG |
| Biotinylated Anti-Human IL-21 | 500-P191Bt-50UG | 50UG |
| Biotinylated Anti-Human/Murine/Rat BMP-2 | 500-P195Bt-25UG | 25UG |
| Anti-Human BMP-7 | 500-P198-100UG | 100UG |
| Anti-Human CXCL16 | 500-P200-100UG | 100UG |
| Anti-Murine CXCL16 | 500-P201G-50UG | 50UG |
| Anti-Human gAcrp30/Adipolean Variant | 500-P205-50UG | 50UG |
| Anti-Human Follistatin | 500-P207-100UG | 100UG |
| Biotinylated Anti-Human Follistatin | 500-P207Bt-25UG | 25UG |
| Anti-Human IL-1RA | 500-P209-1MG | 1MG |
| Biotinylated Anti-Human IL-1RA | 500-P209Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-22 | 500-P211Bt-25UG | 25UG |
| Biotinylated Anti-Human CTGFL/WISP-2 | 500-P212Bt-1MG | 1MG |
| Biotinylated Anti-Human Visfatin | 500-P222Bt-50UG | 50UG |
| Biotinylated Anti-Human sCD22 | 500-P227Bt-50UG | 50UG |
| Anti-Human IGF-BP7 | 500-P234-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP7 | 500-P234Bt-1MG | 1MG |
| Anti-Human Adiponectin | 500-P239-100UG | 100UG |
| Anti-Human TL-1A | 500-P240-100UG | 100UG |
| Biotinylated Anti-Human BD-3 | 500-P241Bt-50UG | 50UG |
| Biotinylated Anti-Human CRP | 500-P242BT-25UG | 25UG |
| Anti-Human AITRL | 500-P244-1MG | 1MG |
| Biotinylated Anti-Human AITRL | 500-P244Bt-1MG | 1MG |
| Anti-Human IL-17B | 500-P248-50UG | 50UG |
| Anti-Human IL-31 | 500-P249-50UG | 50UG |
| Biotinylated Anti-Human Wnt-3a | 500-P251Bt-50UG | 50UG |
| Biotinylated Anti-Human BD-1 | 500-P253Bt-50UG | 50UG |
| Anti-Murine IGF-I | 500-P157G-1MG | 1MG |
| Anti-Murine IGF-I | 500-P157G-50UG | 50UG |
| Anti-Human FGF-16 | 500-P160G-50UG | 50UG |
| Anti-Human BD-2 | 500-P161G-1MG | 1MG |
| Anti-Human FGF-16 | 500-P160G-1MG | 1MG |
| Biotinylated Anti-Human PlGF-1 | 500-P226Bt-50UG | 50UG |
| Murine G-CSF Mini ABTS ELISA Development Kit | 900-M103 | 1kit |
| Murine RANTES (CCL5) Mini ABTS ELISA Development Kit | 900-M124 | 1kit |
| Murine IGF-I Mini ABTS ELISA Development Kit | 900-M170 | 1kit |
| Human Midkine Mini ABTS ELISA Development Kit | 900-M190 | 1kit |
| Biotinylated Anti-Human Vaspin | 500-P256Bt-1MG | 1MG |
| Anti-Human PAI-1 | 500-P260-50UG | 50UG |
| Anti-Human IL-33 | 500-P261-100UG | 100UG |
| Biotinylated Anti-Human Endostatin | 500-P262Bt-25UG | 25UG |
| Biotinylated Anti-Human Endostatin | 500-P262Bt-50UG | 50UG |
| Anti-Human VEGF-B | 500-P267-50UG | 50UG |
| Biotinylated Anti-Human VEGF-B | 500-P267BT-50UG | 50UG |
| Biotinylated Anti-Human Maspin | 500-P270Bt-1MG | 1MG |
| Anti-Human Neuroserpin | 500-P271-50UG | 50UG |
| Anti-Human TIMP-1 | 500-P280-100UG | 100UG |
| Biotinylated Anti-Rat IP-10 (CXCL10) | 500-P290Bt-50UG | 50UG |
| Biotinylated Anti-Human CTACK (CCL27) | 500-P294Bt-1MG | 1MG |
| Anti-Human Klotho | 500-P296-50UG | 50UG |
| Biotinylated Anti-Human Klotho | 500-P296Bt-1MG | 1MG |
| Biotinylated Anti-Human VCAM-1 | 500-P300Bt-50UG | 50UG |
| Biotinylated Anti-Human VCAM-1 | 500-P300Bt-25UG | 25UG |
| Anti-Human TFF-2 | 500-P312-1MG | 1MG |
| Anti-Rat IL-7 | 500-P310-100UG | 100UG |
| Anti-Human IL-36gamma (IL-1F9) | 500-P316-100UG | 100UG |
| Biotinylated Anti-Human IL-36gamma (IL-1F9) | 500-P316Bt-25UG | 25UG |
| Anti-Human TGF-beta3 | 500-P317-100UG | 100UG |
| Biotinylated Anti-Human TGF-beta3 | 500-P317BT-50UG | 50UG |
| Biotinylated Anti-Human MMP-3 | 500-P324BT-25UG | 25UG |
| Anti-Human sCD34 | 500-P327-100UG | 100UG |
| Human GRO-alpha/MGSA (CXCL1) Standard ABTS ELISA Development Kit | 900-K38 | 1kit |
| Human MIP-1alpha (CCL3) Standard ABTS ELISA Development Kit | 900-K35 | 1kit |
| Murine IL-6 Standard ABTS ELISA Development Kit | 900-K50 | 1kit |
| Rat MIP-1alpha (CCL3) Standard ABTS ELISA Development Kit | 900-K75 | 1kit |
| Rat IFN-gamma Standard ABTS ELISA Development Kit | 900-K109 | 1kit |
| Murine MCP-3 (CCL7) Standard ABTS ELISA Development Kit | 900-K123 | 1kit |
| Human sRANK Ligand Standard ABTS ELISA Development Kit | 900-K142 | 1kit |
| Human Resistin Standard ABTS ELISA Development Kit | 900-K235 | 1kit |
| Murine IL-21 Standard ABTS ELISA Development Kit | 900-K368 | 1kit |
| Human TIMP-1 Standard ABTS ELISA Development Kit | 900-K438 | 1kit |
| Human VEGF 165 Mini ABTS ELISA Development Kit | 900-M10 | 1kit |
| Human IL-11 Mini ABTS ELISA Development Kit | 900-M22 | 1kit |
| Murine IL-3 Mini ABTS ELISA Development Kit | 900-M48 | 1kit |
| Murine IL-4 Mini ABTS ELISA Development Kit | 900-M49 | 1kit |
| Human MIG (CXCL9) Mini ABTS ELISA Development Kit | 900-M87 | 1kit |
| Human SDF-1alpha (CXCL12) Mini ABTS ELISA Development Kit | 900-M92 | 1kit |
| Human Eotaxin-3 (CCL26) Mini ABTS ELISA Development Kit | 900-M167 | 1kit |
| Murine IL-13 Mini ABTS ELISA Development Kit | 900-M207 | 1kit |
| Human IGF-BP1 Mini ABTS ELISA Development Kit | 900-M315 | 1kit |
| Human CXCL16 Mini ABTS ELISA Development Kit | 900-M230 | 1kit |
| Human CTACK (CCL27) Mini ABTS ELISA Development Kit | 900-M213 | 1kit |
| Human IL-22 Mini ABTS ELISA Development Kit | 900-M246 | 1kit |
| Human VEGF 165 Standard TMB ELISA Development Kit | 900-T10 | 1kit |
| Human IFN-gamma Mini TMB ELISA Development Kit | 900-TM27 | 1kit |
| Human IL-12 Mini TMB ELISA Development Kit | 900-TM96 | 1kit |
| Animal-Free Human Dendritic Cell Cytokine Package | AF-HDC | 1Pack |
| Human IL-17E Mini TMB ELISA Development Kit | 900-TM234 | 1kit |
| Human Hematopoietic Stem Cell Expansion Cytokine Package (IL-3) | HHSC3 | 1Pack |
| Human Vitronectin Matrix and Buffer Kit | AF-VMB-220 | 1kit |
| Human BD-4 Mini ABTS ELISA Development Kit | 900-M435 | 1kit |
| Rat IP-10 (CXCL10) Mini ABTS ELISA Development Kit | 900-M449 | 1kit |
| Murine IL-4 Standard TMB ELISA Development Kit | 900-T49 | 1kit |
| Human IL-1beta Standard TMB ELISA Development Kit | 900-T95 | 1kit |
| Human SCF Mini TMB ELISA Development Kit | 900-TM34 | 1kit |
| Animal-Free Murine Dendritic Cell Cytokine Package | AF-MDC | 1Pack |
| Human BD-2 Mini TMB ELISA Development Kit | 900-TM172 | 1kit |
| Murine Dendritic Cell Cytokine Package | MDC | 1Pack |
| Murine Hematopoietic Stem Cell Expansion Cytokine Package (IL-3) | MHSC3 | 1Pack |
| Lipid Mixture Solution | LM-200 | 50mL |
| Human IL-8 (CXCL8) Standard TMB ELISA Development Kit | 900-T18 | 1kit |
| Human TNF-alpha Standard TMB ELISA Development Kit | 900-T25 | 1kit |
| Murine IL-6 Standard TMB ELISA Development Kit | 900-T50 | 1kit |
| Human IL-12 Standard TMB ELISA Development Kit | 900-T96 | 1kit |
| Murine IL-2 Mini TMB ELISA Development Kit | 900-TM108 | 1kit |
| PeproGrow-1 Serum-Free Cell Culture Supplement Kit | 700-C100 | 1kit |
| Human TIMP-1 Mini ABTS ELISA Development Kit | 900-M438 | 1kit |
| Human IL-1RA Mini ABTS ELISA Development Kit | 900-M474 | 1kit |
| Human IFN-gamma Standard TMB ELISA Development Kit | 900-T27 | 1kit |
| Murine IL-2 Standard TMB ELISA Development Kit | 900-T108 | 1kit |
| Murine IL-12 Mini TMB ELISA Development Kit | 900-TM97 | 1kit |
| Human/Murine/Rat BMP-2 Mini TMB ELISA Development Kit | 900-TM255 | 1kit |
| PeproGrow hESC (Embryonic Stem Cell) Growth Factor Component | GF-HESC-500 | 500mL |
| Human VEGF-C | 100-20CD-1MG | 1MG |
| Human Sonic Hedgehog (Shh) | 100-45-250UG | 250UG |
| Human Sclerostin | 100-49-500UG | 500UG |
| Human Klotho | 100-53-500UG | 500UG |
| Human Amphiregulin | 100-55B-100UG | 100UG |
| Human Thrombomodulin | 100-58-10UG | 10UG |
| Human HPRG | 100-60-100UG | 100UG |
| Human/Murine/Rat Irisin | 100-65-100UG | 100UG |
| Human p16-INK4a | 110-02-20UG | 20UG |
| Human Sox2 | 110-03-100UG | 100UG |
| Human Sox2-TAT | 110-03T-250UG | 250UG |
| Human Vimentin | 110-10-100UG | 100UG |
| Human sCD4 | 110-11-10UG | 10UG |
| Human Prokineticin-2 | 100-46-1MG | 1MG |
| Anti-Human EPO | 500-P318-100UG | 100UG |
| Biotinylated Anti-Human PD-L1 Fc | 500-P321Bt-1MG | 1MG |
| Anti-Human BD-5 | 500-P323-100UG | 100UG |
| Biotinylated Anti-Human VAP-1 | 500-P326BT-50UG | 50UG |
| ABTS ELISA Buffer Kit | 900-K00 | 1kit |
| Human IL-9 Standard ABTS ELISA Development Kit | 900-K20 | 1kit |
| Human TNF-alpha Standard ABTS ELISA Development Kit | 900-K25 | 1kit |
| Human IL-13 Standard ABTS ELISA Development Kit | 900-K23 | 1kit |
| Human sTRAIL/Apo2L Standard ABTS ELISA Development Kit | 900-K141 | 1kit |
| Human TACI Standard ABTS ELISA Development Kit | 900-K216 | 1kit |
| Murine IL-22 Standard ABTS ELISA Development Kit | 900-K257 | 1kit |
| Human Neuroserpin Standard ABTS ELISA Development Kit | 900-K412 | 1kit |
| Human IL-1RA Standard ABTS ELISA Development Kit | 900-K474 | 1kit |
| Human IP-10 (CXCL10) Mini ABTS ELISA Development Kit | 900-M39 | 1kit |
| Human TPO Mini ABTS ELISA Development Kit | 900-M44 | 1kit |
| Murine IL-1beta Mini ABTS ELISA Development Kit | 900-M47 | 1kit |
| Human IL-12 Mini ABTS ELISA Development Kit | 900-M96 | 1kit |
| Murine MIP-1alpha (CCL3) Mini ABTS ELISA Development Kit | 900-M125 | 1kit |
| Biotinylated Anti-Human Betacellulin | 500-P254Bt-25UG | 25UG |
| Biotinylated Anti-Human Betacellulin | 500-P254Bt-1MG | 1MG |
| Anti-Human MIA-2 | 500-P255-100UG | 100UG |
| Anti-Human NOV | 500-P257-100UG | 100UG |
| Anti-Murine SF-20 | 500-P259-50UG | 50UG |
| Biotinylated Anti-Murine SF-20 | 500-P259Bt-50UG | 50UG |
| Anti-Human Endostatin | 500-P262-1MG | 1MG |
| Biotinylated Anti-Murine IL-17A | 500-P265Bt-25UG | 25UG |
| Biotinylated Anti-Human Maspin | 500-P270Bt-25UG | 25UG |
| Anti-Human Maspin | 500-P270-1MG | 1MG |
| Anti-Rat EGF | 500-P277-1MG | 1MG |
| Anti-Murine IL-21 | 500-P278-100UG | 100UG |
| Anti-Human sDLL-4 | 500-P279-50UG | 50UG |
| Anti-Human ICAM-1 | 500-P287-100UG | 100UG |
| Biotinylated Anti-Human CTACK (CCL27) | 500-P294Bt-25UG | 25UG |
| Anti-Human CTACK (CCL27) | 500-P294-1MG | 1MG |
| Biotinylated Anti-Human sFas Receptor | 500-P295Bt-25UG | 25UG |
| Anti-Human Klotho | 500-P296-1MG | 1MG |
| Biotinylated Anti-Human sTRAIL Receptor-2 | 500-P299Bt-1MG | 1MG |
| Anti-Human sTRAIL Receptor-2 | 500-P299-1MG | 1MG |
| Biotinylated Anti-Human EGF Receptor (EGFR) | 500-P306Bt-25UG | 25UG |
| Biotinylated Anti-Murine TRAIL | 500-P303Bt-25UG | 25UG |
| Biotinylated Anti-Murine LIGHT | 500-P308BT-1MG | 1MG |
| Anti-Rat IL-7 | 500-P310-1MG | 1MG |
| Biotinylated Anti-Human TFF-2 | 500-P312Bt-1MG | 1MG |
| Biotinylated Anti-Human Osteopontin | 500-P314Bt-50UG | 50UG |
| Anti-Human Amphiregulin | 500-P322-1MG | 1MG |
| Biotinylated Anti-Human Amphiregulin | 500-P322Bt-1MG | 1MG |
| Biotinylated Anti-Human sIL-4 Receptor alpha | 500-P325BT-1MG | 1MG |
| Biotinylated Anti-Human VAP-1 | 500-P326BT-1MG | 1MG |
| Biotinylated Anti-Human HB-EGF | 500-P329BT-25UG | 25UG |
| Anti-Human ApoA-I | 500-P331-1MG | 1MG |
| Human FGF-basic Standard ABTS ELISA Development Kit | 900-K08 | 1kit |
| Human EGF Standard ABTS ELISA Development Kit | 900-K05 | 1kit |
| Human IL-4 Standard ABTS ELISA Development Kit | 900-K14 | 1kit |
| Human RANTES (CCL5) Standard ABTS ELISA Development Kit | 900-K33 | 1kit |
| Human TPO Standard ABTS ELISA Development Kit | 900-K44 | 1kit |
| Murine GM-CSF Standard ABTS ELISA Development Kit | 900-K55 | 1kit |
| Murine Leptin Standard ABTS ELISA Development Kit | 900-K76 | 1kit |
| Murine IL-1alpha Standard ABTS ELISA Development Kit | 900-K82 | 1kit |
| Rat IL-1beta Standard ABTS ELISA Development Kit | 900-K91 | 1kit |
| Murine G-CSF Standard ABTS ELISA Development Kit | 900-K103 | 1kit |
| Murine IL-12 Standard ABTS ELISA Development Kit | 900-K97 | 1kit |
| Human I-TAC (CXCL11) Standard ABTS ELISA Development Kit | 900-K151 | 1kit |
| Human Midkine Standard ABTS ELISA Development Kit | 900-K190 | 1kit |
| Human 4-1BB Receptor Standard ABTS ELISA Development Kit | 900-K208 | 1kit |
| Human EG-VEGF Standard ABTS ELISA Development Kit | 900-K244 | 1kit |
| Human Follistatin Standard ABTS ELISA Development Kit | 900-K299 | 1kit |
| Human PAI-1 Standard ABTS ELISA Development Kit | 900-K383 | 1kit |
| Human G-CSF Mini ABTS ELISA Development Kit | 900-M77 | 1kit |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-25UG | 25UG |
| Human IL-4 | 200-04-250UG | 250UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-20UG | 20UG |
| Human IL-7 | 200-07-50UG | 50UG |
| Human GDF-3 | 120-22-500UG | 500UG |
| Human DKK-1 | 120-30-2UG | 2UG |
| Human GDF-7 | 120-37-2UG | 2UG |
| Human Gremlin-1 | 120-42-500UG | 500UG |
| Human DKK-2 | 120-45-1MG | 1MG |
| Human Wnt-9b | 120-49-20UG | 20UG |
| Human sFRP-4 | 120-50-250UG | 250UG |
| Recombinant Human sFRP-5 | 120-53-500ug | 500ug |
| Human MIA-2 | 130-02-250UG | 250UG |
| Human INSL5/INSL7 Hybrid | 130-05-250UG | 250UG |
| Human ANG-2 | 130-07-100UG | 100UG |
| Human Vaspin | 130-11-5UG | 5UG |
| Human C1 Inhibitor | 130-20-1MG | 1MG |
| Murine Granzyme B | 140-03-1MG | 1MG |
| Human PAI-2 | 140-06-500UG | 500UG |
| Human Fetuin A/AHSG | 140-13-50UG | 50UG |
| Human Fetuin A/AHSG | 140-13-250UG | 250UG |
| Human Endostatin | 150-01-250UG | 250UG |
| Human VCAM-1 | 150-04-1MG | 1MG |
| Human Slit2-N | 150-11-5UG | 5UG |
| Human Slit2-N | 150-11-100UG | 100UG |
| Human TIGAR-TAT | 150-14T-25UG | 25UG |
| Human E-Selectin | 150-15-100UG | 100UG |
| Human VAP-1 | 150-16-2UG | 2UG |
| Human Semaphorin 3A Fc | 150-17H-25UG | 25UG |
| Human Uteroglobin | 150-18-10UG | 10UG |
| Human Tissue Factor | 150-19T-50UG | 50UG |
| Human ROR1 | 160-04-500UG | 500UG |
| Human IL-1alpha | 200-01A-10UG | 10UG |
| Human IL-1RA | 200-01Ra-250UG | 250UG |
| Human IL-3 | 200-03-500UG | 500UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-250UG | 250UG |
| Human IL-5 | 200-05-500UG | 500UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-100UG | 100UG |
| Human WISP-1 | 120-18-20UG | 20UG |
| Human Nanog | 120-21-100UG | 100UG |
| Human Nanog | 120-21-1MG | 1MG |
| Human Nanog-TAT | 120-21B-20UG | 20UG |
| Human GDF-3 | 120-22-100UG | 100UG |
| Human GDF-3 | 120-22-1MG | 1MG |
| Human GDF-7 | 120-37-10UG | 10UG |
| Human GDF-7 | 120-37-500UG | 500UG |
| Human Gremlin-1 | 120-42-50UG | 50UG |
| Human DKK-2 | 120-45-100UG | 100UG |
| Human FSTL1 | 120-51-10UG | 10UG |
| Human MIA-2 | 130-02-1MG | 1MG |
| Human OTOR | 130-03-250UG | 250UG |
| Human ANG-1 | 130-06-20UG | 20UG |
| Human Vaspin | 130-11-1mg | 1MG |
| Human Neuroserpin | 130-14-250UG | 250UG |
| Human Relaxin-2 | 130-15-5UG | 5UG |
| Human sDLL-1 | 140-08-100UG | 100UG |
| Human Endostatin | 150-01-500UG | 500UG |
| Human PECAM-1 | 150-06-250UG | 250UG |
| Human PECAM-1 | 150-06-100UG | 100UG |
| Human Slit2-N | 150-11-200UG | 200UG |
| Mycoplasma Arginine Deiminase | 150-12-1MG | 1MG |
| Human Uteroglobin | 150-18-50UG | 50UG |
| Human Tissue Factor | 150-19T-100UG | 100UG |
| Recombinant Human ICAM-2 Fc | 150-22-500ug | 500ug |
| Human TLR-3 | 160-01-100UG | 100UG |
| Human TLR-4 | 160-06-500UG | 500UG |
| Human IL-1beta | 200-01B-1mg | 1MG |
| Human IL-3 | 200-03-50UG | 50UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-5UG | 5UG |
| Human IL-5 | 200-05-1MG | 1MG |
| Human IL-6 | 200-06-100UG | 100UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-250UG | 250UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-50UG | 50UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-1MG | 1MG |
| Human IL-12 p80 | 200-12P80H-250ug | 250UG |
| Human IL-18BP Fc | 200-18BP-20UG | 20UG |
| Human IL-19 | 200-19-100UG | 100UG |
| Human IL-19 | 200-19-500UG | 500UG |
| Human IL-20 | 200-20-500UG | 500UG |
| Human IL-17F | 200-25-100UG | 100UG |
| Human IL-17F | 200-25-1MG | 1MG |
| Human IL-31 | 200-31-2UG | 2UG |
| Human IL-33 | 200-33-500UG | 500UG |
| Human IL-36alpha (IL-1F6) | 200-36A-100UG | 100UG |
| Human IL-36beta (IL-1F8) | 200-36B-100UG | 100UG |
| Human IL-36gamma (IL-1F9) | 200-36G-500UG | 500UG |
| Human IL-27 | 200-38-50UG | 50UG |
| Human IL-27 | 200-38-250UG | 250UG |
| Murine IL-10 | 210-10-50UG | 50UG |
| Murine IL-15 | 210-15-500UG | 500UG |
| Murine IL-17D | 210-17D-5UG | 5UG |
| Murine IL-17E | 210-17E-500UG | 500UG |
| Murine IL-17F | 210-17F-1MG | 1MG |
| Murine IL-22 | 210-22-2UG | 2UG |
| Murine IL-31 | 210-31-2UG | 2UG |
| Murine IL-33 | 210-33-50UG | 50UG |
| Murine IL-36RA | 210-36RA-250UG | 250UG |
| Murine IL-1alpha | 211-11A-2UG | 2UG |
| Murine IL-1alpha | 211-11A-100UG | 100UG |
| Murine IL-3 | 213-13-1MG | 1MG |
| Human MPF | 100-62-500UG | 500UG |
| Recombinant Human EPO | 100-64-500UG | 500UG |
| Human/Murine/Rat Irisin | 100-65-1MG | 1MG |
| Human p16-INK4a-TAT | 110-02T-1MG | 1MG |
| Human Sox2-TAT | 110-03T-25UG | 25UG |
| Human Lin28-TAT | 110-06-250UG | 250UG |
| Human KLF4-TAT | 110-08-1mg | 1MG |
| Human Vimentin | 110-10-1MG | 1MG |
| Human/Murine/Rat Myostatin | 120-00-2UG | 2UG |
| Human/Murine/Rat Myostatin | 120-00-500UG | 500UG |
| Human TSG | 120-09-250UG | 250UG |
| Human Myostatin-Propeptide | 120-12-5UG | 5UG |
| Human Myostatin-Propeptide | 120-12-1MG | 1MG |
| Human Nanog | 120-21-5UG | 5UG |
| Human GDF-3 | 120-22-5UG | 5UG |
| Human GASP-1 | 120-41-25UG | 25UG |
| Human DKK-2 | 120-45-500UG | 500UG |
| Human DKK-3 | 120-46-100UG | 100UG |
| Human Wnt-9b | 120-49-500ug | 500UG |
| Recombinant Human sFRP-5 | 120-53-100ug | 100ug |
| Human OTOR | 130-03-20UG | 20UG |
| Human Relaxin-3 | 130-10-5UG | 5UG |
| Human Vaspin | 130-11-500ug | 500UG |
| Human Maspin | 130-12-5UG | 5UG |
| Murine Granzyme B | 140-03-250UG | 250UG |
| Human ANGPTL-7 | 130-22-500UG | 500UG |
| Human PAI-1 | 140-04-50UG | 50UG |
| Human PAI-1 | 140-04-1MG | 1MG |
| Human sDLL-4 | 140-07-25UG | 25UG |
| Human sDLL-4 | 140-07-1MG | 1MG |
| Human Endostatin | 150-01-100UG | 100UG |
| Human PECAM-1 | 150-06-1MG | 1MG |
| Human TIGAR-TAT | 150-14T-250UG | 250UG |
| Human E-Selectin | 150-15-50UG | 50UG |
| Human Semaphorin 3A Fc | 150-17H-5UG | 5UG |
| Human Semaphorin 3A Fc | 150-17H-1mg | 1MG |
| Human TLR-3 | 160-01-5UG | 5UG |
| Human TLR-3 | 160-01-500ug | 500UG |
| Human TLR-4 | 160-06-250UG | 250UG |
| Human IL-1alpha | 200-01A-2UG | 2UG |
| Human IL-1beta | 200-01B-250UG | 250UG |
| Human IL-1RA | 200-01Ra-100UG | 100UG |
| Human IL-3 | 200-03-250UG | 250UG |
| Human IL-5 | 200-05-2UG | 2UG |
| Human IL-6 | 200-06-500UG | 500UG |
| Human Wnt-1 | 120-17-250UG | 250UG |
| Human WISP-3 | 120-20-5UG | 5UG |
| Human GDF-3 | 120-22-250UG | 250UG |
| Human DKK-1 | 120-30-1MG | 1MG |
| Human DKK-3 | 120-46-1MG | 1MG |
| Human sFRP-4 | 120-50-25UG | 25UG |
| Human INSL5/INSL7 Hybrid | 130-05-1MG | 1MG |
| Human ANG-1 | 130-06-1mg | 1MG |
| Human Vaspin | 130-11-250UG | 250UG |
| Human Neuroserpin | 130-14-500UG | 500UG |
| Human ANGPTL-7 | 130-22-250UG | 250UG |
| Human PAI-2 | 140-06-250UG | 250UG |
| Human PAF-AH | 140-10-100UG | 100UG |
| Human PECAM-1 | 150-06-10UG | 10UG |
| Human PECAM-1 | 150-06-500UG | 500UG |
| Human Slit2-N | 150-11-1mg | 1MG |
| Human TIGAR | 150-14-5UG | 5UG |
| Human TIGAR | 150-14-500UG | 500UG |
| Human VAP-1 | 150-16-1MG | 1MG |
| Human Semaphorin 3A Fc | 150-17H-500ug | 500UG |
| Human Tissue Factor | 150-19T-2UG | 2UG |
| Human Tissue Factor | 150-19T-250UG | 250UG |
| Recombinant Human ICAM-2 Fc | 150-22-1mg | 1mg |
| Human ROR1 | 160-04-1MG | 1MG |
| Human TLR-4 | 160-06-100UG | 100UG |
| Human IL-1alpha | 200-01A-500UG | 500UG |
| Human IL-1RA | 200-01Ra-20UG | 20UG |
| Human IL-27 | 200-38-100UG | 100UG |
| Murine IL-10 | 210-10-2UG | 2UG |
| Murine IL-12 p70 | 210-12-1mg | 1MG |
| Murine IL-13 | 210-13-100UG | 100UG |
| Murine IL-17F | 210-17F-100UG | 100UG |
| Murine SF-20 | 210-25-2UG | 2UG |
| Murine IL-7 | 217-17-50UG | 50UG |
| Murine Eotaxin (CCL11) | 250-01-50UG | 50UG |
| Murine SCF | 250-03-250UG | 250UG |
| Murine MCP-5 (CCL12) | 250-04-1MG | 1MG |
| Murine G-CSF | 250-05-250UG | 250UG |
| Murine C10 (CCL6) | 250-06-10UG | 10UG |
| Murine RANTES (CCL5) | 250-07-100UG | 100UG |
| Murine MIP-1alpha (CCL3) | 250-09-250UG | 250UG |
| Murine KC (CXCL1) | 250-11-500UG | 500UG |
| Murine Exodus-2 (CCL21) | 250-13-100UG | 100UG |
| Murine Exodus-2 (CCL21) | 250-13-1mg | 1MG |
| Murine IP-10 (CXCL10) | 250-16-100UG | 100UG |
| Murine SDF-1alpha (CXCL12) | 250-20A-1MG | 1MG |
| Murine SDF-1beta (CXCL12) | 250-20B-100UG | 100UG |
| Murine Eotaxin-2 (CCL24) | 250-22-20UG | 20UG |
| Murine Eotaxin-2 (CCL24) | 250-22-1MG | 1MG |
| Murine MDC (CCL22) | 250-23-250UG | 250UG |
| Murine Cardiotrophin-1 | 250-25-50UG | 50UG |
| Murine CTACK (CCL27) | 250-26-5UG | 5UG |
| Murine CTACK (CCL27) | 250-26-1MG | 1MG |
| Murine MIP-3beta (CCL19) | 250-27B-1MG | 1MG |
| Murine I-TAC (CXCL11) | 250-29-1MG | 1MG |
| Murine MIP-1beta (CCL4) | 250-32-50UG | 50UG |
| Murine IFN-lambda2 | 250-33-100UG | 100UG |
| Murine IFN-lambda2 | 250-33-1MG | 1MG |
| Murine BD-2 | 250-40-5UG | 5UG |
| Murine BD-2 | 250-40-250UG | 250UG |
| Murine BD-3 | 250-41-5UG | 5UG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-5UG | 5UG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-500UG | 500UG |
| Human TNF-beta | 300-01B-250UG | 250UG |
| Human IFN-omega | 300-02J-100UG | 100UG |
| Human IFN-lambda2 | 300-02K-1MG | 1MG |
| Human MIP-1beta (CCL4) | 300-09-2UG | 2UG |
| Human MIP-1beta (CCL4) | 300-09-250UG | 250UG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-1MG | 1MG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-500UG | 500UG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-100UG | 100UG |
| Human IP-10 (CXCL10) | 300-12-250UG | 250UG |
| Human MCP-2 (CCL8) | 300-15-500UG | 500UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-50UG | 50UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-50UG | 50UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-1MG | 1MG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-250UG | 250UG |
| Human G-CSF | 300-23-250UG | 250UG |
| Human MIG (CXCL9) | 300-26-50UG | 50UG |
| Human M-CSF | 300-25-500UG | 500UG |
| Human SDF-1alpha (CXCL12) | 300-28A-10UG | 10UG |
| Human Fractalkine (CX3CL1) | 300-31-5UG | 5UG |
| Human Eotaxin-2 (CCL24) | 300-33-5UG | 5UG |
| Human Eotaxin-2 (CCL24) | 300-33-100UG | 100UG |
| Human Exodus-2 (CCL21) | 300-35A-50UG | 50UG |
| Human MDC (CCL22) (67 a.a.) | 300-36-1MG | 1MG |
| Human GCP-2 (CXCL6) | 300-41-5UG | 5UG |
| Human NP-1 | 300-42-50UG | 50UG |
| Human NP-1 | 300-42-1MG | 1MG |
| Human LEC (CCL16) | 300-44-250UG | 250UG |
| Human TECK (CCL25) | 300-45-50UG | 50UG |
| Human I-TAC (CXCL11) | 300-46-1MG | 1MG |
| Human BRAK (CXCL14) | 300-50-1MG | 1MG |
| Human MEC (CCL28) | 300-57-100UG | 100UG |
| Human TFF-1 | 300-60-5UG | 5UG |
| Human TFF-1 | 300-60-500UG | 500UG |
| Human TSLP | 300-62-100UG | 100UG |
| Human Chemerin | 300-66-250UG | 250UG |
| Human Nesfatin-1 | 300-67-100UG | 100UG |
| Murine BD-2 | 250-40-1MG | 1MG |
| Murine TARC (CCL17) | 250-43-20UG | 20UG |
| Murine BRAK (CXCL14) | 250-45-1MG | 1MG |
| Human TNF-beta | 300-01B-500UG | 500UG |
| Human IFN-gamma | 300-02-500UG | 500UG |
| Human IFN-beta | 300-02BC-500UG | 500UG |
| Human IFN-lambda2 | 300-02K-20UG | 20UG |
| Human IFN-lambda1 | 300-02L-100UG | 100UG |
| Human MCP-1 (CCL2) | 300-04-500UG | 500UG |
| Human RANTES (CCL5) | 300-06-5UG | 5UG |
| Human RANTES (CCL5) | 300-06-250UG | 250UG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-250UG | 250UG |
| Human NAP-2 (CXCL7) | 300-14-250UG | 250UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-100UG | 100UG |
| Human MCP-3 (CCL7) | 300-17-10UG | 10UG |
| Human MCP-3 (CCL7) | 300-17-500UG | 500UG |
| Human TPO | 300-18-500UG | 500UG |
| Human G-CSF | 300-23-10UG | 10UG |
| Human MCP-4 (CCL13) | 300-24-1MG | 1MG |
| Human SDF-1beta (CXCL12) | 300-28B-2UG | 2UG |
| Human IL-16 (129 a.a.) | 200-16-100UG | 100UG |
| Human IL-16 (121 a.a.) | 200-16A-250UG | 250UG |
| Human IL-17E | 200-24-5UG | 5UG |
| Human IL-17B | 200-28-5UG | 5UG |
| Human IL-33 | 200-33-2UG | 2UG |
| Human IL-34 | 200-34-10UG | 10UG |
| Human IL-36alpha (IL-1F6) | 200-36A-10UG | 10UG |
| Human IL-27 | 200-38-10UG | 10UG |
| Murine IL-1alpha | 211-11A-500UG | 500UG |
| Murine IL-1alpha | 211-11A-1MG | 1MG |
| Murine IL-4 | 214-14-500UG | 500UG |
| Murine IL-9 | 219-19-50UG | 50UG |
| Murine MCP-5 (CCL12) | 250-04-250UG | 250UG |
| Murine RANTES (CCL5) | 250-07-5UG | 5UG |
| Murine MIP-1gamma (CCL9/10) | 250-12-100UG | 100UG |
| Murine MIP-2 (CXCL2) | 250-15-5UG | 5UG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-100UG | 100UG |
| Murine MDC (CCL22) | 250-23-20UG | 20UG |
| Murine MDC (CCL22) | 250-23-1MG | 1MG |
| Murine Neuropoietin | 250-25B-500UG | 500UG |
| Murine Cardiotrophin-1 | 250-25-500UG | 500UG |
| Murine CTACK (CCL27) | 250-26-250UG | 250UG |
| Murine MIP-1beta (CCL4) | 250-32-2UG | 2UG |
| Murine MIP-1beta (CCL4) | 250-32-250UG | 250UG |
| Human IL-11 | 200-11-250UG | 250UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-250UG | 250UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-1MG | 1MG |
| Human IL-12 p80 | 200-12P80H-1mg | 1MG |
| Human IL-16 (129 a.a.) | 200-16-50UG | 50UG |
| Human IL-16 (121 a.a.) | 200-16A-100UG | 100UG |
| Human IL-17A | 200-17-25UG | 25UG |
| Human IL-20 | 200-20-50UG | 50UG |
| Human IL-23 | 200-23-50UG | 50UG |
| Human IL-17F | 200-25-50UG | 50UG |
| Human IL-17B | 200-28-500UG | 500UG |
| Human IL-33 | 200-33-1MG | 1MG |
| Human IL-24 | 200-35-250UG | 250UG |
| Human IL-36beta (IL-1F8) | 200-36B-2UG | 2UG |
| Human IL-36beta (IL-1F8) | 200-36B-500UG | 500UG |
| Human IL-27 | 200-38-2UG | 2UG |
| Murine IL-10 | 210-10-500UG | 500UG |
| Murine IL-12 p40 | 210-12P40H-250UG | 250UG |
| Murine IL-12 p80 | 210-12P80H-500ug | 500UG |
| Murine IL-13 | 210-13-500UG | 500UG |
| Murine IL-17A | 210-17-100UG | 100UG |
| Murine IL-17D | 210-17D-1MG | 1MG |
| Murine IL-17E | 210-17E-1MG | 1MG |
| Murine IL-22 | 210-22-1MG | 1MG |
| Murine IL-1beta | 211-11B-500UG | 500UG |
| Murine IL-7 | 217-17-1mg | 1MG |
| Murine IL-11 | 220-11-2UG | 2UG |
| Murine Eotaxin (CCL11) | 250-01-20UG | 20UG |
| Murine G-CSF | 250-05-100UG | 100UG |
| Murine MCP-3 (CCL7) | 250-08-2UG | 2UG |
| Murine JE/MCP-1 (CCL2) | 250-10-50UG | 50UG |
| Murine IP-10 (CXCL10) | 250-16-50UG | 50UG |
| Murine MIG (CXCL9) | 250-18-250UG | 250UG |
| Murine SDF-1alpha (CXCL12) | 250-20A-500UG | 500UG |
| Murine Neuropoietin | 250-25B-1MG | 1MG |
| Murine MIP-3alpha (CCL20) | 250-27-100UG | 100UG |
| Murine MIP-3beta (CCL19) | 250-27B-500UG | 500UG |
| Murine I-TAC (CXCL11) | 250-29-500UG | 500UG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-250UG | 250UG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-20UG | 20UG |
| Human IL-9 | 200-09-2UG | 2UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-250UG | 250UG |
| Human IL-10 | 200-10-250UG | 250UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-500UG | 500UG |
| Human IL-12 p80 | 200-12P80H-100UG | 100UG |
| Human IL-13 Variant | 200-13A-100UG | 100UG |
| Human IL-15 | 200-15-100UG | 100UG |
| Human IL-16 (129 a.a.) | 200-16-2UG | 2UG |
| Human Apo-SAA1 | 300-53-50UG | 50UG |
| Human CXCL16 | 300-55-5UG | 5UG |
| Human CXCL16 | 300-55-1MG | 1MG |
| Human TFF-1 | 300-60-100UG | 100UG |
| Human TAFA-2 | 300-63-500UG | 500UG |
| Human BD-4 | 300-65-100UG | 100UG |
| Human Chemerin | 300-66-100UG | 100UG |
| Human MIF | 300-69-250UG | 250UG |
| Human GPR15L | 300-71-25UG | 25UG |
| Murine GPR15L | 300-72-1MG | 1MG |
| Human sRANK Ligand (E.coli derived) | 310-01-2UG | 2UG |
| Human sRANK Ligand (E.coli derived) | 310-01-1MG | 1MG |
| Human sRANK Ligand (CHO derived) | 310-01C-50UG | 50UG |
| Recombinant Human sTRAIL/Apo2L | 310-04-10UG | 10UG |
| Recombinant Human sTRAIL/Apo2L | 310-04-50UG | 50UG |
| Human TWEAK | 310-06-25UG | 25UG |
| Human APRIL | 310-10C-50UG | 50UG |
| Human LIGHT | 310-09B-1mg | 1MG |
| Human 4-1BB Ligand | 310-11-1MG | 1MG |
| Human BAFF | 310-13-50UG | 50UG |
| Human BAFF | 310-13-1MG | 1MG |
| Human TACI | 310-17-250UG | 250UG |
| Human TACI | 310-17-1mg | 1MG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-50UG | 50UG |
| Human sFas Receptor | 310-20-500UG | 500UG |
| Human TL-1A | 310-23-5UG | 5UG |
| Human TL-1A | 310-23-1mg | 1MG |
| Human sCD23 | 310-26-100UG | 100UG |
| Human B7-1 Fc | 310-32-250UG | 250UG |
| Human sCD28 Fc | 310-34-250UG | 250UG |
| Human PD-L1 Fc | 310-35-250UG | 250UG |
| Human PD-L1 Fc | 310-35-1MG | 1MG |
| Human sCD8alpha | 310-41-10UG | 10UG |
| Murine M-CSF | 315-02-250UG | 250UG |
| Murine LIGHT | 315-12-5UG | 5UG |
| Murine LIGHT | 315-12-20UG | 20UG |
| Murine sCD40 Ligand | 315-15-100UG | 100UG |
| Murine sCD40 Ligand | 315-15-1MG | 1MG |
| Murine Prolactin | 315-16-250UG | 250UG |
| Murine Betacellulin | 315-21-250UG | 250UG |
| Murine Sonic Hedgehog (Shh) | 315-22-500ug | 500UG |
| Murine Adiponectin | 315-26-100UG | 100UG |
| Murine TFF-1 | 315-31-20UG | 20UG |
| Murine Amphiregulin | 315-36-500UG | 500UG |
| Murine C5a | 315-40-250UG | 250UG |
| Viral MIP-2 | 350-03-100UG | 100UG |
| Viral MIP-2 | 350-03-1MG | 1MG |
| Rat IL-1alpha | 400-01A-100UG | 100UG |
| Rat IL-1beta | 400-01B-100UG | 100UG |
| Rat IL-1beta | 400-01B-1MG | 1MG |
| Human sRANK Ligand (CHO derived) | 310-01C-10UG | 10UG |
| Human sTNF Receptor Type I | 310-07-5UG | 5UG |
| Human LIGHT | 310-09B-100ug | 100UG |
| Human sTNF Receptor Type II | 310-12-5UG | 5UG |
| Human 4-1BB Ligand | 310-11-5UG | 5UG |
| Human BAFF Receptor | 310-13R-10UG | 10UG |
| Human 4-1BB Receptor | 310-15-100UG | 100UG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-10UG | 10UG |
| Human TWEAK Receptor | 310-21-250UG | 250UG |
| Human sFas Receptor | 310-20-250UG | 250UG |
| Human sOX40 Ligand | 310-28-10UG | 10UG |
| Human sOX40 Ligand | 310-28-1MG | 1MG |
| Human sCD27 Ligand | 310-30-1MG | 1MG |
| Human B7-2 Fc | 310-33-20UG | 20UG |
| Human PD-1 Fc | 310-40-250UG | 250UG |
| Murine TNF-alpha | 315-01A-250UG | 250UG |
| Murine M-CSF | 315-02-500UG | 500UG |
| Murine GM-CSF | 315-03-250UG | 250UG |
| Murine sRANK Ligand (E.coli derived) | 315-11-500UG | 500UG |
| Murine Sonic Hedgehog (Shh) | 315-22-25UG | 25UG |
| Murine TFF-1 | 315-31-5UG | 5UG |
| Murine TFF-1 | 315-31-100UG | 100UG |
| Murine VCAM-1 | 315-37-250UG | 250UG |
| Murine Prokineticin-2 | 315-38-5UG | 5UG |
| Murine C5a | 315-40-1MG | 1MG |
| Human ApoE4 | 350-04-500UG | 500UG |
| Rat IL-1alpha | 400-01A-1MG | 1MG |
| Rat IL-2 | 400-02-5UG | 5UG |
| Rat IL-3beta | 400-03-250UG | 250UG |
| Human sRANK Ligand (E.coli derived) | 310-01-100UG | 100UG |
| Human sRANK Ligand (CHO derived) | 310-01C-500UG | 500UG |
| Recombinant Human sTRAIL/Apo2L | 310-04-100UG | 100UG |
| Human CTLA-4 Fc | 310-05-1MG | 1MG |
| Human sTNF Receptor Type I | 310-07-20UG | 20UG |
| Human sTNF Receptor Type II | 310-12-20UG | 20UG |
| Human BAFF Receptor | 310-13R-50UG | 50UG |
| Human BAFF Receptor | 310-13R-1MG | 1MG |
| Human 4-1BB Receptor | 310-15-500UG | 500UG |
| Human BCMA | 310-16-250UG | 250UG |
| Human TACI | 310-17-20UG | 20UG |
| Recombinant Human sTRAIL Receptor-2 | 310-19-50UG | 50UG |
| Human sFas Receptor | 310-20-20UG | 20UG |
| Human sFas Receptor | 310-20-1MG | 1MG |
| Human TWEAK Receptor | 310-21-500UG | 500UG |
| Human AITRL | 310-22-1MG | 1MG |
| Human sCD23 | 310-26-5UG | 5UG |
| Human sCD23 | 310-26-500UG | 500UG |
| Human HVEM-Fc | 310-27-500ug | 500UG |
| Human sOX40 Ligand | 310-28-500UG | 500UG |
| Human sCD27 Ligand | 310-30-250UG | 250UG |
| Human MCP-1 (CCL2) | 300-04-250UG | 250UG |
| Human MIP-1alpha (CCL3) | 300-08-250UG | 250UG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-1MG | 1MG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-500UG | 500UG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-250UG | 250UG |
| Human IP-10 (CXCL10) | 300-12-100UG | 100UG |
| Human Apo-SAA | 300-13-250UG | 250UG |
| Human NAP-2 (CXCL7) | 300-14-500UG | 500UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-500UG | 500UG |
| Human MCP-3 (CCL7) | 300-17-100UG | 100UG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-100UG | 100UG |
| Human MIG (CXCL9) | 300-26-100UG | 100UG |
| Human M-CSF | 300-25-250UG | 250UG |
| Human Leptin Receptor | 300-27R-20UG | 20UG |
| Human SDF-1beta (CXCL12) | 300-28B-250UG | 250UG |
| Human MIP-3 (CCL23) | 300-29-5UG | 5UG |
| Human MIP-3alpha (CCL20) | 300-29A-50UG | 50UG |
| Human MIP-3alpha (CCL20) | 300-29A-5UG | 5UG |
| Human TARC (CCL17) | 300-30-50UG | 50UG |
| Human TARC (CCL17) | 300-30-500UG | 500UG |
| Human Fractalkine (CX3CL1) | 300-31-100UG | 100UG |
| Human Exodus-2 (CCL21) | 300-35A-250UG | 250UG |
| Human MDC (CCL22) (69 a.a.) | 300-36A-5UG | 5UG |
| Human MDC (CCL22) (69 a.a.) | 300-36A-250UG | 250UG |
| Human I-309 (CCL1) | 300-37-2UG | 2UG |
| Human I-309 (CCL1) | 300-37-1MG | 1MG |
| Human HCC-1 (CCL14) (66 a.a.) | 300-38B-10UG | 10UG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-500UG | 500UG |
| Human MIP-5 (CCL15) | 300-43-50UG | 50UG |
| Human LEC (CCL16) | 300-44-100UG | 100UG |
| Human Eotaxin-3 (CCL26) | 300-48-5UG | 5UG |
| Human BD-2 | 300-49-100UG | 100UG |
| Human BD-2 | 300-49-1MG | 1MG |
| Human BD-3 | 300-52-1MG | 1MG |
| Human LD78beta (CCL3L1) | 300-56-5UG | 5UG |
| Human LAG-1 (CCL4L1) | 300-58-5UG | 5UG |
| Human LAG-1 (CCL4L1) | 300-58-500UG | 500UG |
| Human TFF-2 | 300-59-20UG | 20UG |
| Human TAFA-2 | 300-63-100UG | 100UG |
| Human BD-4 | 300-65-250UG | 250UG |
| Human BD-5 | 300-68-100UG | 100UG |
| Human MIF | 300-69-5UG | 5UG |
| Human MIF | 300-69-500UG | 500UG |
| Human TNF-alpha | 300-01A-500UG | 500UG |
| Human IFN-beta | 300-02BC-100UG | 100UG |
| Human IFN-omega | 300-02J-20UG | 20UG |
| Human IFN-lambda1 | 300-02L-5UG | 5UG |
| Human IFN-lambda1 | 300-02L-1MG | 1MG |
| Human IFN-lambda1 | 300-02L-250UG | 250UG |
| Human RANTES (CCL5) | 300-06-20UG | 20UG |
| Human RANTES (CCL5) | 300-06-500UG | 500UG |
| Human MIP-1alpha (CCL3) | 300-08-100UG | 100UG |
| Human NAP-2 (CXCL7) | 300-14-1MG | 1MG |
| Human MCP-2 (CCL8) | 300-15-250UG | 250UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-5UG | 5UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-250UG | 250UG |
| Human MCP-3 (CCL7) | 300-17-2UG | 2UG |
| Human Lymphotactin (XCL1) | 300-20-1mg | 1MG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-20UG | 20UG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-20UG | 20UG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-500UG | 500UG |
| Human Leptin Receptor | 300-27R-500UG | 500UG |
| Human SDF-1beta (CXCL12) | 300-28B-50UG | 50UG |
| Human MDC (CCL22) (69 a.a.) | 300-36A-50UG | 50UG |
| Human I-309 (CCL1) | 300-37-500UG | 500UG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-1MG | 1MG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-10UG | 10UG |
| Human GCP-2 (CXCL6) | 300-41-100UG | 100UG |
| Human LEC (CCL16) | 300-44-20UG | 20UG |
| Human LEC (CCL16) | 300-44-1MG | 1MG |
| Human TECK (CCL25) | 300-45-500UG | 500UG |
| Human BCA-1 (CXCL13) | 300-47-1MG | 1MG |
| Rat IL-6 | 400-06-100UG | 100UG |
| Rat GRO-beta/MIP-2 (CXCL2) | 400-11-5UG | 5UG |
| Rat GRO/KC (CXCL1) | 400-10-250UG | 250UG |
| Rat MCP-1 (CCL2) | 400-12-50UG | 50UG |
| Rat MCP-1 (CCL2) | 400-12-1mg | 1MG |
| Rat IL-13 (109 a.a.) | 400-16-100UG | 100UG |
| Rat IL-10 | 400-19-100UG | 100UG |
| Rat IFN-gamma | 400-20-1MG | 1MG |
| Rat GM-CSF | 400-23-5UG | 5UG |
| Rat GM-CSF | 400-23-500UG | 500UG |
| Rat Fractalkine (CX3CL1) | 400-26-250UG | 250UG |
| Rat Prolactin | 400-27-100UG | 100UG |
| Rat M-CSF | 400-28-500UG | 500UG |
| Rat SDF-1beta (CXCL12) | 400-32B-100UG | 100UG |
| Rat IP-10 (CXCL10) | 400-33-500UG | 500UG |
| Rat TPO | 400-34-1MG | 1MG |
| Rat Resistin | 400-35-500UG | 500UG |
| Human TIMP-1 | 410-01-2UG | 2UG |
| Human TIMP-1 | 410-01-250UG | 250UG |
| Human TIMP-2 | 410-02-1MG | 1MG |
| Human MMP-1 | 420-01-250UG | 250UG |
| Human NT-4 | 450-04-100UG | 100UG |
| Human NT-4 | 450-04-1MG | 1MG |
| Human Midkine | 450-16-1MG | 1MG |
| Human gAcrp30/Adipolean | 450-21-25UG | 25UG |
| Human Adiponectin | 450-24-25UG | 25UG |
| Human RELMbeta | 450-22-250UG | 250UG |
| Murine RELMalpha | 450-26-250UG | 250UG |
| Murine RELMbeta | 450-26B-5UG | 5UG |
| Murine gAcrp30 | 450-27-50UG | 50UG |
| Murine gAcrp30 | 450-27-100UG | 100UG |
| Murine Persephin | 450-35-1MG | 1MG |
| Human/Rat Neuritin | 450-36D-100UG | 100UG |
| Human GMF-beta | 450-37-500UG | 500UG |
| Human Galectin-1 | 450-39-10UG | 10UG |
| Human Galectin-1 | 450-39-500UG | 500UG |
| Yeast Kex-2 | 450-45-50UG | 50UG |
| Human Enterokinase | 450-48C-100UG | 100UG |
| Murine Artemin | 450-58-250UG | 250UG |
| Rat IL-7 | 400-07-500UG | 500UG |
| Rat IL-6 | 400-06-250UG | 250UG |
| Rat MIP-1beta (CCL4) | 400-09-5UG | 5UG |
| Rat GRO/KC (CXCL1) | 400-10-100UG | 100UG |
| Rat GRO-beta/MIP-2 (CXCL2) | 400-11-500UG | 500UG |
| Biotinylated Anti-Human PEDF | 500-P263BT-50UG | 50ug |
| Anti-Human PEDF | 500-P263-50UG | 50ug |
| Anti-Human MMP-2 | 500-P307-50UG | 50ug |
| Anti-Human FGF-23 | 500-P319-100UG | 100ug |
| Anti-Human NT-4 (Polyclonal Rabbit) | 500-P83-1MG | 1mg |
| Anti-Human PEDF | 500-P263-1MG | 1mg |
| Anti-Human IL-12 (HEK293-derived immunogen) | 500-P154HG-1MG | 1mg |
| Biotinylated Anti-Human NT-4 (Polyclonal Rabbit) | 500-P83BT-25UG | 25ug |
| Biotinylated Anti-Rat IL-1beta | 500-P80Bt-50UG | 50UG |
| Biotinylated Anti-Human PEDF | 500-P263BT-25UG | 25ug |
| Aeromonas Aminopeptidase | 100-10-500UG | 500UG |
| Human Sclerostin | 100-49-20UG | 20UG |
| Human Thrombomodulin | 100-58-500UG | 500UG |
| Human MPF | 100-62-50UG | 50UG |
| Human/Murine/Rat Irisin | 100-65-250UG | 250UG |
| Human sCD14 | 110-01-100UG | 100UG |
| Human p16-INK4a | 110-02-1mg | 1MG |
| Human p16-INK4a-TAT | 110-02T-250UG | 250UG |
| Human Sox2 | 110-03-1MG | 1MG |
| Human KLF4-TAT | 110-08-250ug | 250UG |
| Human Sonic Hedgehog (Shh) | 100-45-5UG | 5UG |
| Human Sonic Hedgehog (Shh) | 100-45-500UG | 500UG |
| Human Sclerostin | 100-49-100UG | 100UG |
| Human Betacellulin | 100-50-250UG | 250UG |
| Human Amphiregulin | 100-55B-250UG | 250UG |
| Human MPF | 100-62-250UG | 250UG |
| Recombinant Human EPO | 100-64-250UG | 250UG |
| Human p16-INK4a-TAT | 110-02T-5UG | 5UG |
| Human Sox2 | 110-03-5UG | 5UG |
| Human Sox2-TAT | 110-03T-5UG | 5UG |
| Human KLF4-TAT | 110-08-500ug | 500UG |
| Human/Murine/Rat Myostatin | 120-00-100UG | 100UG |
| Human TSG | 120-09-100UG | 100UG |
| Aeromonas Aminopeptidase | 100-10-1mg | 1MG |
| Recombinant Human EPO | 100-64-50UG | 50UG |
| Human sCD14 | 110-01-1MG | 1MG |
| Human Lin28-TAT | 110-06-500UG | 500UG |
| Human TSG | 120-09-500UG | 500UG |
| Human Myostatin-Propeptide | 120-12-250UG | 250UG |
| Human Sonic Hedgehog (Shh) | 100-45-1mg | 1MG |
| Human Betacellulin | 100-50-5UG | 5UG |
| Human Klotho | 100-53-250UG | 250UG |
| Human Thrombomodulin | 100-58-2UG | 2UG |
| Human Mesothelin | 100-63-50UG | 50UG |
| Human Mesothelin | 100-63-1MG | 1MG |
| Human/Murine/Rat Irisin | 100-65-10UG | 10UG |
| Human sCD14 | 110-01-10UG | 10UG |
| Human p16-INK4a-TAT | 110-02T-25UG | 25UG |
| Human Sox2-TAT | 110-03T-1MG | 1MG |
| Human sCD4 | 110-11-100UG | 100UG |
| Human Myostatin-Propeptide | 120-12-500UG | 500UG |
| Human WISP-1 | 120-18-100UG | 100UG |
| Human WISP-3 | 120-20-20UG | 20UG |
| Human Nanog-TAT | 120-21B-250UG | 250UG |
| Human Nanog-TAT | 120-21B-500UG | 500UG |
| Human DKK-1 | 120-30-100UG | 100UG |
| Human Gremlin-1 | 120-42-250UG | 250UG |
| Human DKK-2 | 120-45-10UG | 10UG |
| Recombinant Human sFRP-5 | 120-53-250ug | 250ug |
| Human OTOR | 130-03-100UG | 100UG |
| Human INSL5/INSL7 Hybrid | 130-05-100UG | 100UG |
| Human ANG-2 | 130-07-500UG | 500UG |
| Human GLP-1 | 130-08-1MG | 1MG |
| Human Relaxin-3 | 130-10-500UG | 500UG |
| Human Maspin | 130-12-500UG | 500UG |
| Human PEDF | 130-13-500UG | 500UG |
| Human Relaxin-2 | 130-15-100UG | 100UG |
| Human C1 Inhibitor | 130-20-500UG | 500UG |
| Human sDLL-1 | 140-08-250UG | 250UG |
| Human Fetuin A/AHSG | 140-13-10UG | 10UG |
| Human Fetuin A/AHSG | 140-13-1MG | 1MG |
| Human VCAM-1 | 150-04-500UG | 500UG |
| Human ICAM-1 | 150-05-100UG | 100UG |
| Mycoplasma Arginine Deiminase | 150-12-250UG | 250UG |
| Human TIGAR | 150-14-25UG | 25UG |
| Human TIGAR-TAT | 150-14T-5UG | 5UG |
| Human E-Selectin | 150-15-1MG | 1MG |
| Human Uteroglobin | 150-18-500UG | 500UG |
| Human Tissue Factor | 150-19T-10UG | 10UG |
| Human ROR1 | 160-04-250UG | 250UG |
| Human TLR-4 | 160-06-50UG | 50UG |
| Human MD-2/LY96 | 160-07-500UG | 500UG |
| Human IL-1RA | 200-01Ra-1MG | 1MG |
| Human Wnt-1 | 120-17-100UG | 100UG |
| Human WISP-3 | 120-20-250UG | 250UG |
| Human Nanog-TAT | 120-21B-5UG | 5UG |
| Human DKK-1 | 120-30-50UG | 50UG |
| Human Osteopontin | 120-35-100UG | 100UG |
| Human GDF-7 | 120-37-50UG | 50UG |
| Human DKK-2 | 120-45-250UG | 250UG |
| Human Wnt-9b | 120-49-250ug | 250UG |
| Human MIA-2 | 130-02-20UG | 20UG |
| Human OTOR | 130-03-5UG | 5UG |
| Human OTOR | 130-03-500UG | 500UG |
| Human Maspin | 130-12-250UG | 250UG |
| Human PEDF | 130-13-100UG | 100UG |
| Human PEDF | 130-13-250UG | 250UG |
| Human Relaxin-2 | 130-15-25UG | 25UG |
| Human ANGPTL-3 | 130-18-10UG | 10UG |
| Human ANGPTL-7 | 130-22-100UG | 100UG |
| Human PAI-1 | 140-04-10UG | 10UG |
| Human PAI-1 | 140-04-500UG | 500UG |
| Human sDLL-4 | 140-07-5UG | 5UG |
| Human sDLL-4 | 140-07-500UG | 500UG |
| Human PAF-AH | 140-10-5UG | 5UG |
| Human PAF-AH | 140-10-1MG | 1MG |
| Human Endostatin | 150-01-20UG | 20UG |
| Mycoplasma Arginine Deiminase | 150-12-100UG | 100UG |
| Human Uteroglobin | 150-18-250UG | 250UG |
| Recombinant Human ICAM-2 Fc | 150-22-50ug | 50ug |
| Human TLR-3 | 160-01-200UG | 200UG |
| Human ROR1 | 160-04-100UG | 100UG |
| Human TLR-4 | 160-06-1MG | 1MG |
| Human IL-1alpha | 200-01A-100UG | 100UG |
| Human IL-5 | 200-05-100UG | 100UG |
| Human WISP-1 | 120-18-5UG | 5UG |
| Human WISP-1 | 120-18-250UG | 250UG |
| Human WISP-3 | 120-20-1mg | 1MG |
| Human GDF-3 | 120-22-20UG | 20UG |
| Human DKK-1 | 120-30-250UG | 250UG |
| Human Osteopontin | 120-35-10UG | 10UG |
| Human GDF-7 | 120-37-250UG | 250UG |
| Human Gremlin-1 | 120-42-10UG | 10UG |
| Human DKK-2 | 120-45-50UG | 50UG |
| Human DKK-3 | 120-46-250UG | 250UG |
| Recombinant Human sFRP-5 | 120-53-50ug | 50ug |
| Human MIA | 130-01-100UG | 100UG |
| Human MIA-2 | 130-02-500UG | 500UG |
| Human Relaxin-3 | 130-10-25UG | 25UG |
| Human Maspin | 130-12-1MG | 1MG |
| Human PEDF | 130-13-20UG | 20UG |
| Human Neuroserpin | 130-14-5UG | 5UG |
| Human ANGPTL-3 | 130-18-50UG | 50UG |
| Murine Granzyme B | 140-03-2UG | 2UG |
| Human PAI-1 | 140-04-100UG | 100UG |
| Human sDLL-4 | 140-07-100UG | 100UG |
| Human sDLL-1 | 140-08-1MG | 1MG |
| Human ICAM-1 | 150-05-500UG | 500UG |
| Human VAP-1 | 150-16-250UG | 250UG |
| Human TLR-3 | 160-01-25UG | 25UG |
| Human MD-2/LY96 | 160-07-50UG | 50UG |
| Human IL-1alpha | 200-01A-250UG | 250UG |
| Human IL-1beta | 200-01B-500UG | 500UG |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-1MG | 1MG |
| Human IL-4 | 200-04-1MG | 1MG |
| Human IL-6 | 200-06-1MG | 1MG |
| Human IL-7 | 200-07-250UG | 250UG |
| Human GASP-1 | 120-41-250UG | 250UG |
| Human DKK-3 | 120-46-500UG | 500UG |
| Human Wnt-9b | 120-49-100UG | 100UG |
| Human sFRP-4 | 120-50-5UG | 5UG |
| Human MIA | 130-01-500UG | 500UG |
| Human INSL5/INSL7 Hybrid | 130-05-5UG | 5UG |
| Human INSL5/INSL7 Hybrid | 130-05-500UG | 500UG |
| Human ANG-1 | 130-06-500ug | 500UG |
| Human ANG-2 | 130-07-1MG | 1MG |
| Human PEDF | 130-13-5UG | 5UG |
| Human PEDF | 130-13-1MG | 1MG |
| Human ANGPTL-7 | 130-22-20UG | 20UG |
| Human ANGPTL-7 | 130-22-1MG | 1MG |
| Human sDLL-4 | 140-07-250UG | 250UG |
| Human sDLL-1 | 140-08-25UG | 25UG |
| Human PAF-AH | 140-10-20UG | 20UG |
| Human PAF-AH | 140-10-500UG | 500UG |
| Human Fetuin A/AHSG | 140-13-100UG | 100UG |
| Human VCAM-1 | 150-04-250UG | 250UG |
| Human Slit2-N | 150-11-500ug | 500UG |
| Human TIGAR-TAT | 150-14T-1mg | 1MG |
| Human E-Selectin | 150-15-250UG | 250UG |
| Human VAP-1 | 150-16-50UG | 50UG |
| Human Semaphorin 3A Fc | 150-17H-100UG | 100UG |
| Human IL-1beta | 200-01B-10UG | 10UG |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-5UG | 5UG |
| Human IL-3 | 200-03-1MG | 1MG |
| Human IL-5 | 200-05-50UG | 50UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-5UG | 5UG |
| Human IL-10 | 200-10-100UG | 100UG |
| Human IL-11 | 200-11-500UG | 500UG |
| Human IL-12 p80 | 200-12P80H-2UG | 2UG |
| Human IL-13 | 200-13-1MG | 1MG |
| Murine IL-31 | 210-31-500UG | 500UG |
| Murine IL-33 | 210-33-500ug | 500UG |
| Murine IL-1beta | 211-11B-1mg | 1MG |
| Murine IL-2 | 212-12-1MG | 1MG |
| Murine IL-7 | 217-17-250UG | 250UG |
| Murine IL-9 | 219-19-10UG | 10UG |
| Murine Eotaxin (CCL11) | 250-01-250UG | 250UG |
| Murine SCF | 250-03-1MG | 1MG |
| Murine MCP-5 (CCL12) | 250-04-100UG | 100UG |
| Murine G-CSF | 250-05-2UG | 2UG |
| Murine G-CSF | 250-05-500UG | 500UG |
| Murine C10 (CCL6) | 250-06-1MG | 1MG |
| Murine MIP-1alpha (CCL3) | 250-09-2UG | 2UG |
| Murine JE/MCP-1 (CCL2) | 250-10-2UG | 2UG |
| Murine JE/MCP-1 (CCL2) | 250-10-100UG | 100UG |
| Murine KC (CXCL1) | 250-11-100UG | 100UG |
| Murine MCP-2 (CCL8) | 250-14-5UG | 5UG |
| Murine Exodus-2 (CCL21) | 250-13-500UG | 500UG |
| Murine MCP-2 (CCL8) | 250-14-1MG | 1MG |
| Murine MIP-2 (CXCL2) | 250-15-500UG | 500UG |
| Murine IP-10 (CXCL10) | 250-16-250UG | 250UG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-20UG | 20UG |
| Murine MDC (CCL22) | 250-23-500UG | 500UG |
| Murine Cardiotrophin-1 | 250-25-100UG | 100UG |
| Murine Cardiotrophin-1 | 250-25-250UG | 250UG |
| Murine MIP-3alpha (CCL20) | 250-27-5UG | 5UG |
| Murine CXCL16 | 250-28-5UG | 5UG |
| Murine MEC (CCL28) | 250-30-1MG | 1MG |
| Murine MIP-1beta (CCL4) | 250-32-100UG | 100UG |
| Human IL-12 p70 (CHO derived) | 200-12-1mg | 1MG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-50UG | 50UG |
| Human IL-12 p80 | 200-12P80H-500ug | 500UG |
| Human IL-15 | 200-15-500UG | 500UG |
| Human IL-15 | 200-15-250UG | 250UG |
| Human IL-16 (129 a.a.) | 200-16-500UG | 500UG |
| Human IL-17A | 200-17-100UG | 100UG |
| Human IL-18BP Fc | 200-18BP-100UG | 100UG |
| Human IL-20 | 200-20-2UG | 2UG |
| Human IL-21 | 200-21-50UG | 50UG |
| Human IL-17E | 200-24-25UG | 25UG |
| Human IL-17D | 200-27-5UG | 5UG |
| Human IL-33 | 200-33-100UG | 100UG |
| Human IL-24 | 200-35-20UG | 20UG |
| Human IL-36alpha (IL-1F6) | 200-36A-250UG | 250UG |
| Human IL-36alpha (IL-1F6) | 200-36A-1mg | 1MG |
| Human IL-35 | 200-37-1mg | 1MG |
| Human IL-27 | 200-38-1MG | 1MG |
| Human IL-37 (IL-1F7) | 200-39-500UG | 500UG |
| Murine IL-10 | 210-10-250UG | 250UG |
| Murine IL-12 p80 | 210-12P80H-10UG | 10UG |
| Murine IL-17A | 210-17-50UG | 50UG |
| Murine IL-21 | 210-21-500UG | 500UG |
| Murine SF-20 | 210-25-100UG | 100UG |
| Murine IL-31 | 210-31-10UG | 10UG |
| Murine IL-33 | 210-33-100UG | 100UG |
| Murine IL-36RA | 210-36RA-5UG | 5UG |
| Murine IL-36RA | 210-36RA-500UG | 500UG |
| Murine IL-1alpha | 211-11A-10UG | 10UG |
| Murine IL-3 | 213-13-500UG | 500UG |
| Murine IL-5 | 215-15-25UG | 25UG |
| Murine IL-5 | 215-15-100UG | 100UG |
| Murine IL-7 | 217-17-500UG | 500UG |
| Murine IL-11 | 220-11-100UG | 100UG |
| Murine Eotaxin (CCL11) | 250-01-1MG | 1MG |
| Murine MCP-3 (CCL7) | 250-08-10UG | 10UG |
| Murine KC (CXCL1) | 250-11-1mg | 1MG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-1MG | 1MG |
| Murine SDF-1alpha (CXCL12) | 250-20A-2UG | 2UG |
| Murine SDF-1beta (CXCL12) | 250-20B-10UG | 10UG |
| Murine MIP-3beta (CCL19) | 250-27B-250UG | 250UG |
| Murine CXCL16 | 250-28-1MG | 1MG |
| Murine MEC (CCL28) | 250-30-5UG | 5UG |
| Human IL-9 | 200-09-50UG | 50UG |
| Human IL-12 p70 (CHO derived) | 200-12-100UG | 100UG |
| Human IL-13 | 200-13-100UG | 100UG |
| Human IL-16 (121 a.a.) | 200-16A-2UG | 2UG |
| Human IL-17A | 200-17-250UG | 250UG |
| Human IL-17A | 200-17-500UG | 500UG |
| Human IL-19 | 200-19-10UG | 10UG |
| Human IL-19 | 200-19-1MG | 1MG |
| Human IL-21 | 200-21-2UG | 2UG |
| Human IL-21 | 200-21-500UG | 500UG |
| Human IL-22 | 200-22-100UG | 100UG |
| Human IL-17F | 200-25-5UG | 5UG |
| Human IL-36RA | 200-36RA-25UG | 25UG |
| Human IL-35 | 200-37-500ug | 500UG |
| Human IL-37 (IL-1F7) | 200-39-5UG | 5UG |
| Murine IL-12 p70 | 210-12-50UG | 50UG |
| Murine IL-17F | 210-17F-25UG | 25UG |
| Murine IL-21 | 210-21-1MG | 1MG |
| Murine IL-33 | 210-33-2UG | 2UG |
| Murine IL-36RA | 210-36RA-100UG | 100UG |
| Murine IL-36RA | 210-36RA-25UG | 25UG |
| Murine IL-3 | 213-13-100UG | 100UG |
| Murine IL-5 | 215-15-250UG | 250UG |
| Murine IL-9 | 219-19-2UG | 2UG |
| Murine IL-11 | 220-11-50UG | 50UG |
| Murine SCF | 250-03-500UG | 500UG |
| Murine MCP-5 (CCL12) | 250-04-20UG | 20UG |
| Murine MCP-5 (CCL12) | 250-04-500UG | 500UG |
| Murine C10 (CCL6) | 250-06-2UG | 2UG |
| Murine MCP-3 (CCL7) | 250-08-50UG | 50UG |
| Murine MIP-1alpha (CCL3) | 250-09-500UG | 500UG |
| Murine KC (CXCL1) | 250-11-5UG | 5UG |
| Murine MCP-2 (CCL8) | 250-14-20UG | 20UG |
| Murine Exodus-2 (CCL21) | 250-13-250UG | 250UG |
| Murine SDF-1beta (CXCL12) | 250-20B-250UG | 250UG |
| Murine Eotaxin-2 (CCL24) | 250-22-500UG | 500UG |
| Murine MDC (CCL22) | 250-23-100UG | 100UG |
| Murine Cardiotrophin-1 | 250-25-10UG | 10UG |
| Murine Neuropoietin | 250-25B-100UG | 100UG |
| Murine Cardiotrophin-1 | 250-25-1MG | 1MG |
| Murine MIP-3beta (CCL19) | 250-27B-5UG | 5UG |
| Murine CXCL16 | 250-28-100UG | 100UG |
| Murine I-TAC (CXCL11) | 250-29-5UG | 5UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-500UG | 500UG |
| Human IL-12 p70 (CHO derived) | 200-12-2UG | 2UG |
| Human IL-12 p70 (CHO derived) | 200-12-250UG | 250UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-10UG | 10UG |
| Human IL-13 Variant | 200-13A-10UG | 10UG |
| Human IL-16 (121 a.a.) | 200-16A-10UG | 10UG |
| Human IL-16 (121 a.a.) | 200-16A-1MG | 1MG |
| Human IL-18BP Fc | 200-18BP-500UG | 500UG |
| Human IL-20 | 200-20-10UG | 10UG |
| Human IL-17E | 200-24-250UG | 250UG |
| Human IL-17F | 200-25-25UG | 25UG |
| Human IL-17F | 200-25-500UG | 500UG |
| Human IL-17D | 200-27-100UG | 100UG |
| Human IL-17B | 200-28-100UG | 100UG |
| Human IL-31 | 200-31-100UG | 100UG |
| Human IL-31 | 200-31-1MG | 1MG |
| Human IL-24 | 200-35-500UG | 500UG |
| Human IL-36beta (IL-1F8) | 200-36B-1MG | 1MG |
| Human IL-36RA | 200-36RA-500UG | 500UG |
| Murine IL-10 | 210-10-100UG | 100UG |
| Murine IL-12 p70 | 210-12-500UG | 500UG |
| Murine IL-12 p40 | 210-12P40H-50UG | 50UG |
| Murine IL-12 p80 | 210-12P80H-50UG | 50UG |
| Murine IL-17A | 210-17-25UG | 25UG |
| Murine IL-17A | 210-17-1MG | 1MG |
| Murine IL-17E | 210-17E-5UG | 5UG |
| Murine IL-21 | 210-21-50UG | 50UG |
| Murine IL-22 | 210-22-10UG | 10UG |
| Murine IL-22 | 210-22-250UG | 250UG |
| Murine SF-20 | 210-25-1MG | 1MG |
| Murine IL-33 | 210-33-250ug | 250UG |
| Murine IL-1alpha | 211-11A-50UG | 50UG |
| Murine IL-1beta | 211-11B-250UG | 250UG |
| Murine IL-2 | 212-12-250UG | 250UG |
| Murine IL-3 | 213-13-50UG | 50UG |
| Murine IL-5 | 215-15-500UG | 500UG |
| Murine IL-7 | 217-17-100UG | 100UG |
| Murine IL-9 | 219-19-100UG | 100UG |
| Murine Eotaxin (CCL11) | 250-01-100UG | 100UG |
| Murine SCF | 250-03-50UG | 50UG |
| Murine MIP-1alpha (CCL3) | 250-09-10UG | 10UG |
| Murine MIP-1alpha (CCL3) | 250-09-1MG | 1MG |
| Murine KC (CXCL1) | 250-11-20UG | 20UG |
| Murine MIP-1gamma (CCL9/10) | 250-12-500UG | 500UG |
| Murine MCP-2 (CCL8) | 250-14-500UG | 500UG |
| Murine MIP-2 (CXCL2) | 250-15-50UG | 50UG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-5UG | 5UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-20UG | 20UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-500UG | 500UG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-1MG | 1MG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-5UG | 5UG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-20UG | 20UG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-100UG | 100UG |
| Murine BD-2 | 250-40-20UG | 20UG |
| Murine BD-2 | 250-40-500UG | 500UG |
| Murine TARC (CCL17) | 250-43-5UG | 5UG |
| Murine TARC (CCL17) | 250-43-250UG | 250UG |
| Murine BRAK (CXCL14) | 250-45-500UG | 500UG |
| Human TNF-beta | 300-01B-5UG | 5UG |
| Human IFN-lambda2 | 300-02K-100UG | 100UG |
| Human IFN-lambda1 | 300-02L-500UG | 500UG |
| Human MCP-1 (CCL2) | 300-04-1MG | 1MG |
| Human SCF | 300-07-2UG | 2UG |
| Human SCF | 300-07-250UG | 250UG |
| Human MIP-1alpha (CCL3) | 300-08-20UG | 20UG |
| Human HCC-1 (CCL14) (66 a.a.) | 300-38B-1MG | 1MG |
| Human GRO-beta (CXCL2) | 300-39-250UG | 250UG |
| Human GRO-gamma (CXCL3) | 300-40-10UG | 10UG |
| Human GCP-2 (CXCL6) | 300-41-1mg | 1MG |
| Human MIP-5 (CCL15) | 300-43-100UG | 100UG |
| Human I-TAC (CXCL11) | 300-46-5UG | 5UG |
| Human Eotaxin-3 (CCL26) | 300-48-20UG | 20UG |
| Human Eotaxin-3 (CCL26) | 300-48-1MG | 1MG |
| Human BD-1 (47 a.a.) | 300-51A-500UG | 500UG |
| Human BD-3 | 300-52-500UG | 500UG |
| Human LD78beta (CCL3L1) | 300-56-20UG | 20UG |
| Human LD78beta (CCL3L1) | 300-56-500UG | 500UG |
| Human TAFA-2 | 300-63-5UG | 5UG |
| Human TSLP | 300-62-2UG | 2UG |
| Human BD-4 | 300-65-5UG | 5UG |
| Human BD-4 | 300-65-500UG | 500UG |
| Human Nesfatin-1 | 300-67-20UG | 20UG |
| Human C5a | 300-70-20UG | 20UG |
| Human MIF | 300-69-1MG | 1MG |
| Human GPR15L | 300-71-250UG | 250UG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-250UG | 250UG |
| Recombinant Murine PF-4 (CXCL4) | 250-39-1MG | 1MG |
| Murine BD-3 | 250-41-100UG | 100UG |
| Murine BRAK (CXCL14) | 250-45-100UG | 100UG |
| Human TNF-beta | 300-01B-20UG | 20UG |
| Human IFN-beta | 300-02BC-50UG | 50UG |
| Human IFN-omega | 300-02J-500UG | 500UG |
| Human GM-CSF | 300-03-1MG | 1MG |
| Human MCP-1 (CCL2) | 300-04-50UG | 50UG |
| Human SCF | 300-07-10UG | 10UG |
| Human MIP-1alpha (CCL3) | 300-08-1MG | 1MG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-50UG | 50UG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-250UG | 250UG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-10UG | 10UG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-50UG | 50UG |
| Human IP-10 (CXCL10) | 300-12-1MG | 1MG |
| Human NAP-2 (CXCL7) | 300-14-2UG | 2UG |
| Human Eotaxin (CCL11) | 300-21-50UG | 50UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-100UG | 100UG |
| Human G-CSF | 300-23-500UG | 500UG |
| Human MIG (CXCL9) | 300-26-20UG | 20UG |
| Human MIG (CXCL9) | 300-26-250UG | 250UG |
| Human MIP-3 (CCL23) | 300-29-250UG | 250UG |
| Human MIP-3beta (CCL19) | 300-29B-100UG | 100UG |
| Human Fractalkine (CX3CL1) | 300-31-20UG | 20UG |
| Human Cardiotrophin-1 | 300-32-100UG | 100UG |
| Human GRO-beta (CXCL2) | 300-39-10UG | 10UG |
| Human GRO-beta (CXCL2) | 300-39-500UG | 500UG |
| Human GCP-2 (CXCL6) | 300-41-20UG | 20UG |
| Human TECK (CCL25) | 300-45-250UG | 250UG |
| Human Eotaxin-3 (CCL26) | 300-48-100UG | 100UG |
| Human BD-1 (36 a.a.) | 300-51-250UG | 250UG |
| Human Apo-SAA1 | 300-53-250UG | 250UG |
| Human CTACK (CCL27) | 300-54-1MG | 1MG |
| Human CXCL16 | 300-55-500UG | 500UG |
| Human CTACK (CCL27) | 300-54-100UG | 100UG |
| Human MEC (CCL28) | 300-57-250ug | 250UG |
| Human TFF-3 | 300-61-250UG | 250UG |
| Human TAFA-2 | 300-63-250UG | 250UG |
| Human BD-4 | 300-65-1MG | 1MG |
| Human Nesfatin-1 | 300-67-200UG | 200UG |
| Human BD-5 | 300-68-500UG | 500UG |
| Human GPR15L | 300-71-5UG | 5UG |
| Murine BD-3 | 250-41-50UG | 50UG |
| Murine BD-3 | 250-41-1MG | 1MG |
| Murine BRAK (CXCL14) | 250-45-250UG | 250UG |
| Human TNF-beta | 300-01B-100UG | 100UG |
| Human IFN-lambda2 | 300-02K-5UG | 5UG |
| Human IFN-lambda2 | 300-02K-500UG | 500UG |
| Human GM-CSF | 300-03-500UG | 500UG |
| Human MIP-1alpha (CCL3) | 300-08-5UG | 5UG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-250UG | 250UG |
| Human MCP-3 (CCL7) | 300-17-1MG | 1MG |
| Human Lymphotactin (XCL1) | 300-20-20UG | 20UG |
| Human Eotaxin (CCL11) | 300-21-5UG | 5UG |
| Human Eotaxin (CCL11) | 300-21-100UG | 100UG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-1MG | 1MG |
| Human G-CSF | 300-23-100UG | 100UG |
| Human Cardiotrophin-1 | 300-32-500UG | 500UG |
| Human Eotaxin-2 (CCL24) | 300-33-1MG | 1MG |
| Human GRO-gamma (CXCL3) | 300-40-2UG | 2UG |
| Human GRO-gamma (CXCL3) | 300-40-250UG | 250UG |
| Human GCP-2 (CXCL6) | 300-41-250UG | 250UG |
| Human TECK (CCL25) | 300-45-20UG | 20UG |
| Human BCA-1 (CXCL13) | 300-47-50UG | 50UG |
| Human BD-2 | 300-49-50UG | 50UG |
| Human BD-3 | 300-52-250UG | 250UG |
| Human CTACK (CCL27) | 300-54-250UG | 250UG |
| Human TFF-1 | 300-60-250UG | 250UG |
| Human TFF-3 | 300-61-20UG | 20UG |
| Human TSLP | 300-62-10UG | 10UG |
| Human TAFA-2 | 300-63-1MG | 1MG |
| Human Chemerin | 300-66-25UG | 25UG |
| Human Chemerin | 300-66-1MG | 1MG |
| Human Nesfatin-1 | 300-67-1MG | 1MG |
| Human GPR15L | 300-71-100UG | 100UG |
| Human IFN-omega | 300-02J-1MG | 1MG |
| Human IFN-lambda2 | 300-02K-250UG | 250UG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-100UG | 100UG |
| Human MIP-1beta (CCL4) | 300-09-1MG | 1MG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-2UG | 2UG |
| Human IP-10 (CXCL10) | 300-12-50UG | 50UG |
| Human Apo-SAA | 300-13-10UG | 10UG |
| Human Apo-SAA | 300-13-500UG | 500UG |
| Human NAP-2 (CXCL7) | 300-14-10UG | 10UG |
| Human MCP-3 (CCL7) | 300-17-50UG | 50UG |
| Human Lymphotactin (XCL1) | 300-20-5UG | 5UG |
| Human G-CSF | 300-23-50UG | 50UG |
| Human G-CSF | 300-23-1MG | 1MG |
| Human MIG (CXCL9) | 300-26-1MG | 1MG |
| Human SDF-1beta (CXCL12) | 300-28B-1MG | 1MG |
| Human MIP-3 (CCL23) | 300-29-20UG | 20UG |
| Human MIP-3beta (CCL19) | 300-29B-250UG | 250UG |
| Human Fractalkine (CX3CL1) | 300-31-1MG | 1MG |
| Human Cardiotrophin-1 | 300-32-250UG | 250UG |
| Human Eotaxin-2 (CCL24) | 300-33-20UG | 20UG |
| Human MIP-4 (CCL18) | 300-34-50UG | 50UG |
| Human MIP-4 (CCL18) | 300-34-1MG | 1MG |
| Human Exodus-2 (CCL21) | 300-35A-100UG | 100UG |
| Human MDC (CCL22) (67 a.a.) | 300-36-5UG | 5UG |
| Human MDC (CCL22) (67 a.a.) | 300-36-500UG | 500UG |
| Human MDC (CCL22) (69 a.a.) | 300-36A-100UG | 100UG |
| Human GRO-beta (CXCL2) | 300-39-2UG | 2UG |
| Human GRO-beta (CXCL2) | 300-39-1mg | 1MG |
| Human GRO-gamma (CXCL3) | 300-40-500UG | 500UG |
| Human GCP-2 (CXCL6) | 300-41-500UG | 500UG |
| Human MIP-5 (CCL15) | 300-43-500UG | 500UG |
| Human I-TAC (CXCL11) | 300-46-250UG | 250UG |
| Human BRAK (CXCL14) | 300-50-100UG | 100UG |
| Human BD-1 (36 a.a.) | 300-51-20UG | 20UG |
| Human BD-1 (36 a.a.) | 300-51-500UG | 500UG |
| Human BD-1 (47 a.a.) | 300-51A-20UG | 20UG |
| Human BD-3 | 300-52-5UG | 5UG |
| Human Apo-SAA1 | 300-53-500UG | 500UG |
| Human MEC (CCL28) | 300-57-5UG | 5UG |
| Human LAG-1 (CCL4L1) | 300-58-250UG | 250UG |
| Human TFF-2 | 300-59-500UG | 500UG |
| Human TFF-3 | 300-61-5UG | 5UG |
| Human Chemerin | 300-66-5UG | 5UG |
| Human Nesfatin-1 | 300-67-500UG | 500UG |
| Human BD-5 | 300-68-1MG | 1MG |
| Human C5a | 300-70-1mg | 1MG |
| Human GPR15L | 300-71-1MG | 1MG |
| Human TWEAK | 310-06-250UG | 250UG |
| Human sTNF Receptor Type I | 310-07-100UG | 100UG |
| Human sRANK Receptor | 310-08-1MG | 1MG |
| Human LIGHT | 310-09B-250ug | 250UG |
| Human sTNF Receptor Type II | 310-12-500UG | 500UG |
| Human BAFF Receptor | 310-13R-250UG | 250UG |
| Human 4-1BB Receptor | 310-15-20UG | 20UG |
| Human BCMA | 310-16-5UG | 5UG |
| Human BCMA | 310-16-1MG | 1MG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-500UG | 500UG |
| Human sOX40 Ligand | 310-28-250UG | 250UG |
| Human sCD27 Ligand | 310-30-100UG | 100UG |
| Human sCD34 | 310-31-1MG | 1MG |
| Human TREM-1 Fc | 310-36-250UG | 250UG |
| Human TREM-1 Fc | 310-36-500UG | 500UG |
| Human ICOS Fc | 310-39-500UG | 500UG |
| Human ICOS Fc | 310-39-1MG | 1MG |
| Murine TNF-alpha | 315-01A-1MG | 1MG |
| Murine sRANK Ligand (E.coli derived) | 315-11-250UG | 250UG |
| Murine sRANK Ligand (CHO derived) | 315-11C-2UG | 2UG |
| Murine APRIL | 315-13-500UG | 500UG |
| Murine sCD40 Ligand | 315-15-5UG | 5UG |
| Murine Prolactin | 315-16-500UG | 500UG |
| Murine Sonic Hedgehog (Shh) | 315-22-5UG | 5UG |
| Murine Adiponectin | 315-26-250UG | 250UG |
| Murine TFF-1 | 315-31-1MG | 1MG |
| Murine Prokineticin-2 | 315-38-1MG | 1MG |
| Human ApoA-I | 350-11-100UG | 100UG |
| Rat Carboxypeptidase-B | 400-00-25UG | 25UG |
| Rat IL-1alpha | 400-01A-50UG | 50UG |
| Rat IL-3beta | 400-03-100UG | 100UG |
| Human sRANK Ligand (CHO derived) | 310-01C-250UG | 250UG |
| Human sRANK Ligand (CHO derived) | 310-01C-1MG | 1MG |
| Recombinant Human sTRAIL/Apo2L | 310-04-500UG | 500UG |
| Human CTLA-4 Fc | 310-05-500UG | 500UG |
| Human sTNF Receptor Type I | 310-07-250UG | 250UG |
| Human sRANK Receptor | 310-08-250UG | 250UG |
| Murine Prolactin | 315-16-10UG | 10UG |
| Murine Betacellulin | 315-21-500UG | 500UG |
| Murine Midkine | 315-25-100UG | 100UG |
| Murine Adiponectin | 315-26-5UG | 5UG |
| Murine Prokineticin-2 | 315-38-250UG | 250UG |
| Viral MIP-2 | 350-03-50UG | 50UG |
| Rat Carboxypeptidase-B | 400-00-100UG | 100UG |
| Rat Carboxypeptidase-B | 400-00-500UG | 500UG |
| Rat IL-1alpha | 400-01A-2UG | 2UG |
| Rat IL-3beta | 400-03-500UG | 500UG |
| Recombinant Human sTRAIL/Apo2L | 310-04-1MG | 1MG |
| Human TWEAK | 310-06-1MG | 1MG |
| Human sTNF Receptor Type I | 310-07-500UG | 500UG |
| Human sRANK Receptor | 310-08-100UG | 100UG |
| Human APRIL | 310-10C-2UG | 2UG |
| Human 4-1BB Ligand | 310-11-250UG | 250UG |
| Human BAFF | 310-13-5UG | 5UG |
| Human BAFF | 310-13-100UG | 100UG |
| Human 4-1BB Receptor | 310-15-250UG | 250UG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-250UG | 250UG |
| Recombinant Human sTRAIL Receptor-2 | 310-19-250UG | 250UG |
| Human AITRL | 310-22-20UG | 20UG |
| Human GITR/TNFRSF18 Fc | 310-22R-500UG | 500UG |
| Human TL-1A | 310-23-250UG | 250UG |
| Human sOX40 Ligand | 310-28-100UG | 100UG |
| Human sCD100 | 310-29-250UG | 250UG |
| Human B7-H2 Fc | 310-37-100UG | 100UG |
| Human PD-L2 Fc | 310-38-500UG | 500UG |
| Human PD-1 Fc | 310-40-500UG | 500UG |
| Murine GM-CSF | 315-03-1MG | 1MG |
| Murine sRANK Ligand (CHO derived) | 315-11C-10UG | 10UG |
| Murine sRANK Ligand (E.coli derived) | 315-11-1MG | 1MG |
| Murine sRANK Ligand (CHO derived) | 315-11C-500UG | 500UG |
| Murine TPO | 315-14-250UG | 250UG |
| Murine Prolactin | 315-16-50UG | 50UG |
| Murine Betacellulin | 315-21-5UG | 5UG |
| Murine Betacellulin | 315-21-20UG | 20UG |
| Murine Midkine | 315-25-250UG | 250UG |
| Murine Adiponectin | 315-26-25UG | 25UG |
| Murine VCAM-1 | 315-37-500UG | 500UG |
| Viral MIP-2 | 350-03-250UG | 250UG |
| Human ApoA-I | 350-11-20UG | 20UG |
| Human ApoE2 | 350-12-500UG | 500UG |
| Murine GPR15L | 300-72-500UG | 500UG |
| Human sRANK Ligand (E.coli derived) | 310-01-250UG | 250UG |
| Human APRIL | 310-10C-500ug | 500UG |
| Human sTNF Receptor Type II | 310-12-100UG | 100UG |
| Human BAFF Receptor | 310-13R-100UG | 100UG |
| Human 4-1BB Receptor | 310-15-5UG | 5UG |
| Human BCMA | 310-16-500UG | 500UG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-100UG | 100UG |
| Human TWEAK Receptor | 310-21-1MG | 1MG |
| Human AITRL | 310-22-100UG | 100UG |
| Human GITR/TNFRSF18 Fc | 310-22R-20UG | 20UG |
| Human TL-1A | 310-23-500UG | 500UG |
| Human sCD23 | 310-26-1MG | 1MG |
| Human sCD100 | 310-29-500UG | 500UG |
| Human sCD34 | 310-31-20UG | 20UG |
| Human B7-1 Fc | 310-32-1MG | 1MG |
| Human B7-1 Fc | 310-32-100UG | 100UG |
| Human B7-H2 Fc | 310-37-250UG | 250UG |
| Human PD-1 Fc | 310-40-50UG | 50UG |
| Human TMIGD2/CD28H Fc | 310-42-1MG | 1MG |
| Murine M-CSF | 315-02-1MG | 1MG |
| Murine LIGHT | 315-12-1MG | 1MG |
| Murine sCD40 Ligand | 315-15-250UG | 250UG |
| Murine Sonic Hedgehog (Shh) | 315-22-250UG | 250UG |
| Murine Midkine | 315-25-5UG | 5UG |
| Murine Adiponectin | 315-26-50UG | 50UG |
| Murine TFF-2 | 315-30-20UG | 20UG |
| Murine TFF-2 | 315-30-500UG | 500UG |
| Murine TFF-1 | 315-31-500UG | 500UG |
| Murine VCAM-1 | 315-37-50UG | 50UG |
| Murine VCAM-1 | 315-37-1MG | 1MG |
| Murine Prokineticin-2 | 315-38-500UG | 500UG |
| Viral MIP-2 | 350-03-10UG | 10UG |
| Viral MIP-2 | 350-03-500UG | 500UG |
| Human ApoA-I | 350-11-1MG | 1MG |
| Rat Carboxypeptidase-B | 400-00-5UG | 5UG |
| Rat Carboxypeptidase-B | 400-00-50UG | 50UG |
| Rat IL-1beta | 400-01B-50UG | 50UG |
| Rat IL-3beta | 400-03-20UG | 20UG |
| Rat IL-3beta | 400-03-5UG | 5UG |
| Rat IL-3beta | 400-03-1MG | 1MG |
| Rat IL-5 | 400-05-500ug | 500UG |
| Rat IL-6 | 400-06-2UG | 2UG |
| Rat IL-6 | 400-06-500UG | 500UG |
| Rat MIP-1beta (CCL4) | 400-09-20UG | 20UG |
| Rat RANTES (CCL5) | 400-13-20UG | 20UG |
| Rat RANTES (CCL5) | 400-13-100UG | 100UG |
| Rat IL-13 (113 a.a.) | 400-16L-1MG | 1MG |
| Rat SCF | 400-22-2UG | 2UG |
| Rat Leptin | 400-21-1MG | 1MG |
| Rat IFN-gamma | 400-20-100UG | 100UG |
| Rat GM-CSF | 400-23-1MG | 1MG |
| Rat IL-15 | 400-24-500UG | 500UG |
| Rat Prolactin | 400-27-50UG | 50UG |
| Rat IP-10 (CXCL10) | 400-33-25UG | 25UG |
| Rat TPO | 400-34-250UG | 250UG |
| Rat Resistin | 400-35-100UG | 100UG |
| Murine IL-2 | 212-12-500UG | 500UG |
| Human IL-34 | 200-34-100UG | 100UG |
| Human Sonic Hedgehog (Shh) | 100-45-25UG | 25UG |
| Human/Murine/Rat BDNF | AF-450-02-10UG | 10UG |
| Murine M-CSF | AF-315-02-10UG | 10UG |
| Murine GM-CSF | AF-315-03-20UG | 20UG |
| Human BCA-1 (CXCL13) | 300-47-5UG | 5UG |
| Human IL-3 | 200-03-10UG | 10UG |
| Rat IL-4 | 400-04-5UG | 5UG |
| Human SCF | 300-07-100UG | 100UG |
| Human BMP-4 (E.coli derived) | 120-05ET-10UG | 10UG |
| Human sCD40 Ligand | 310-02-10UG | 10UG |
| Human ApoE3 | 350-02-1mg | 1MG |
| Human IL-22 | 200-22-10UG | 10UG |
| Human ApoE3 | 350-02-500UG | 500UG |
| Rat Resistin | 400-35-1MG | 1MG |
| Rat G-CSF | 400-37-250UG | 250UG |
| Human TIMP-1 | 410-01-1MG | 1MG |
| Human TIMP-2 | 410-02-250UG | 250UG |
| Human MMP-3 | 420-03-10UG | 10UG |
| Human NT-4 | 450-04-250UG | 250UG |
| Human Persephin | 450-12-20UG | 20UG |
| Human Persephin | 450-12-500UG | 500UG |
| Human Midkine | 450-16-5UG | 5UG |
| Human Resistin | 450-19-5UG | 5UG |
| Human gAcrp30/Adipolean | 450-21-250UG | 250UG |
| Human RELMbeta | 450-22-1MG | 1MG |
| Murine RELMbeta | 450-26B-100UG | 100UG |
| Murine gAcrp30 | 450-27-500UG | 500UG |
| Murine Resistin | 450-28-25UG | 25UG |
| Murine Leptin | 450-31-5MG | 5MG |
| Human/Rat Neuritin | 450-36D-5UG | 5UG |
| Human/Rat Neuritin | 450-36D-500UG | 500UG |
| Human Galectin-1 | 450-39-100UG | 100UG |
| Human sCD30 Ligand | 450-42-50UG | 50UG |
| Staphylococcus Glu-C | 450-46-250UG | 250UG |
| Lysobacter Enzymogenes Arg-C | 450-54-20UG | 20UG |
| Rat IL-5 | 400-05-200UG | 200UG |
| Rat IL-6 | 400-06-10UG | 10UG |
| Rat MIP-1beta (CCL4) | 400-09-500UG | 500UG |
| Rat GRO/KC (CXCL1) | 400-10-25UG | 25UG |
| Rat RANTES (CCL5) | 400-13-250UG | 250UG |
| Rat RANTES (CCL5) | 400-13-1MG | 1MG |
| Rat IFN-gamma | 400-20-250UG | 250UG |
| Rat GM-CSF | 400-23-50UG | 50UG |
| Rat TPO | 400-34-2UG | 2UG |
| Recombinant Rat Oncostatin M | 400-36-2UG | 2UG |
| Recombinant Rat Oncostatin M | 400-36-100UG | 100UG |
| Rat G-CSF | 400-37-1MG | 1MG |
| Rat IL-21 | 400-41-1MG | 1MG |
| Human MMP-3 | 420-03-1MG | 1MG |
| Human NT-4 | 450-04-10UG | 10UG |
| Human CDNF | 450-05-250UG | 250UG |
| Human MANF | 450-06-25UG | 25UG |
| Human Neurturin | 450-11-5UG | 5UG |
| Human Neurturin | 450-11-250UG | 250UG |
| Human Midkine | 450-16-250UG | 250UG |
| Human NNT-1/BCSF-3 | 450-18-500UG | 500UG |
| Human Resistin | 450-19-500UG | 500UG |
| Murine Resistin | 450-28-500UG | 500UG |
| Murine Leptin | 450-31-200UG | 200UG |
| Murine IL-15 | 210-15-2UG | 2UG |
| Murine IFN-gamma | 315-05-500UG | 500UG |
| Human Amphiregulin | 100-55B-1MG | 1MG |
| Human CTACK (CCL27) | 300-54-20UG | 20UG |
| Human IL-13 | 200-13-10UG | 10UG |
| Anti-Murine IL-10 | 500-P60-100UG | 100UG |
| Human ApoE4 | 350-04-1mg | 1MG |
| Anti-Human IL-1alpha | 500-P21A-50UG | 50UG |
| Murine IL-11 | 220-11-10UG | 10UG |
| Human TGF-beta1 (CHO derived) | AF-100-21C-10UG | 10UG |
| Murine M-CSF | AF-315-02-50UG | 50UG |
| Human SCF | AF-300-07-1MG | 1MG |
| Murine IL-7 | 217-17-2UG | 2UG |
| Human IL-13 | 200-13-2UG | 2UG |
| Human IL-1alpha | AF-200-01A-10UG | 10UG |
| Murine RANTES (CCL5) | 250-07-20UG | 20UG |
| Murine JE/MCP-1 (CCL2) | 250-10-10UG | 10UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-5UG | 5UG |
| Human BRAK (CXCL14) | 300-50-20UG | 20UG |
| Human Epiregulin | 100-04-500UG | 500UG |
| Aeromonas Aminopeptidase | 100-10-100UG | 100UG |
| Human sCD22 | 100-01-1MG | 1MG |
| Recombinant Human Heregulinbeta-1 | 100-03-250UG | 250UG |
| Human Epiregulin | 100-04-25UG | 25UG |
| Human Epiregulin | AF-100-04-500UG | 500UG |
| Human Vitronectin | AF-140-09-500UG | 500UG |
| Human IL-1RA | AF-200-01RA-1MG | 1MG |
| Human IL-4 | AF-200-04-1MG | 1MG |
| Human IL-6 | AF-200-06-500UG | 500UG |
| Human IL-9 | AF-200-09-10UG | 10UG |
| Human IL-9 | AF-200-09-250UG | 250UG |
| Human IL-11 | AF-200-11-2UG | 2UG |
| Human IL-13 | AF-200-13-500UG | 500UG |
| Human IL-15 | AF-200-15-500UG | 500UG |
| Human IL-22 | AF-200-22-500UG | 500UG |
| Human IL-17E | AF-200-24-1MG | 1MG |
| Human IL-17D | AF-200-27-25UG | 25UG |
| Human IL-37 (IL-1F7) | AF-200-39-5UG | 5UG |
| Murine IL-10 | AF-210-10-10UG | 10UG |
| Murine IL-21 | AF-210-21-250UG | 250UG |
| Murine IL-22 | AF-210-22-500UG | 500UG |
| Murine IL-1beta | AF-211-11B-500UG | 500UG |
| Murine IL-3 | AF-213-13-10UG | 10UG |
| Murine IL-3 | AF-213-13-100UG | 100UG |
| Murine IL-6 | AF-216-16-2UG | 2UG |
| Murine IL-6 | AF-216-16-250UG | 250UG |
| Murine SCF | AF-250-03-100UG | 100UG |
| Murine BD-3 | AF-250-41-1MG | 1MG |
| Human TNF-alpha | AF-300-01A-100UG | 100UG |
| Human IFN-beta | AF-300-02B-500UG | 500UG |
| Human IFN-lambda1 | AF-300-02L-250UG | 250UG |
| Human MCP-1 (CCL2) | AF-300-04-20UG | 20UG |
| Human MCP-2 (CCL8) | AF-300-15-1MG | 1MG |
| Human TPO | AF-300-18-500UG | 500UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-500UG | 500UG |
| Human BD-5 | AF-300-68-500UG | 500UG |
| Human TWEAK | AF-310-06-25UG | 25UG |
| Animal-Free Recombinant Human Heregulinbeta-1 | AF-100-03-250UG | 250UG |
| Human GDF-3 | AF-120-22-5UG | 5UG |
| Human GDF-3 | AF-120-22-100UG | 100UG |
| Human GDF-3 | AF-120-22-1MG | 1MG |
| Human IL-3 | AF-200-03-2UG | 2UG |
| Human IL-6 | AF-200-06-100UG | 100UG |
| Human IL-9 | AF-200-09-2UG | 2UG |
| Human IL-10 | AF-200-10-10UG | 10UG |
| Human IL-10 | AF-200-10-2UG | 2UG |
| Human IL-15 | AF-200-15-1MG | 1MG |
| Human IL-16 (121 a.a.) | AF-200-16A-10UG | 10UG |
| Human IL-16 (121 a.a.) | AF-200-16A-500UG | 500UG |
| Human IL-17E | AF-200-24-5UG | 5UG |
| Human IL-33 | AF-200-33-2UG | 2UG |
| Murine IL-10 | AF-210-10-50UG | 50UG |
| Murine IL-22 | AF-210-22-2UG | 2UG |
| Murine IL-1beta | AF-211-11B-10UG | 10UG |
| Murine IL-4 | AF-214-14-1MG | 1MG |
| Murine IL-6 | AF-216-16-100UG | 100UG |
| Murine SCF | AF-250-03-50UG | 50UG |
| Murine BD-3 | AF-250-41-500UG | 500UG |
| Human IFN-gamma | AF-300-02-500UG | 500UG |
| Human MCP-1 (CCL2) | AF-300-04-50UG | 50UG |
| Human GRO-alpha/MGSA (CXCL1) | AF-300-11-25UG | 25UG |
| Human Eotaxin (CCL11) | AF-300-21-250UG | 250UG |
| Human C5a | AF-300-70-20UG | 20UG |
| Human TWEAK | AF-310-06-100UG | 100UG |
| Human TWEAK | AF-310-06-500UG | 500UG |
| Murine Artemin | 450-58-5UG | 5UG |
| Human IL-1beta | AF-200-01B-100UG | 100UG |
| Human IL-3 | AF-200-03-50UG | 50UG |
| Human IL-5 | AF-200-05-250UG | 250UG |
| Human IL-8 (CXCL8) (72 a.a.) | AF-200-08M-100UG | 100UG |
| Human IL-9 | AF-200-09-500UG | 500UG |
| Human IL-17E | AF-200-24-250UG | 250UG |
| Human IL-33 | AF-200-33-250UG | 250UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-500UG | 500UG |
| Murine IL-22 | AF-210-22-1MG | 1MG |
| Murine IL-1beta | AF-211-11B-250UG | 250UG |
| Murine G-CSF | AF-250-05-2UG | 2UG |
| Murine G-CSF | AF-250-05-50UG | 50UG |
| Human TNF-alpha | AF-300-01A-500UG | 500UG |
| Human MCP-1 (CCL2) | AF-300-04-100UG | 100UG |
| Human RANTES (CCL5) | AF-300-06-20UG | 20UG |
| Human GRO-alpha/MGSA (CXCL1) | AF-300-11-250UG | 250UG |
| Human MCP-2 (CCL8) | AF-300-15-500UG | 500UG |
| Human M-CSF | AF-300-25-2UG | 2UG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-500UG | 500UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-1MG | 1MG |
| Human I-TAC (CXCL11) | AF-300-46-500UG | 500UG |
| Human sCD40 Ligand | AF-310-02-1MG | 1MG |
| Human sCD40 Ligand | AF-310-02-10UG | 10UG |
| Human 4-1BB Ligand | AF-310-11-100UG | 100UG |
| Human sTNF Receptor Type I | AF-310-07-20UG | 20UG |
| Human BAFF | AF-310-13-20UG | 20UG |
| Human BAFF | AF-310-13-100UG | 100UG |
| Human BAFF | AF-310-13-500UG | 500UG |
| Human Epiregulin | AF-100-04-1MG | 1MG |
| Human IL-1beta | AF-200-01B-250UG | 250UG |
| Human IL-2 | AF-200-02-50UG | 50UG |
| Human IL-2 | AF-200-02-500UG | 500UG |
| Human IL-3 | AF-200-03-100UG | 100UG |
| Human IL-6 | AF-200-06-50UG | 50UG |
| Human IL-6 | AF-200-06-1MG | 1MG |
| Human IL-8 (CXCL8) (72 a.a.) | AF-200-08M-5UG | 5UG |
| Human IL-9 | AF-200-09-1MG | 1MG |
| Human IL-11 | AF-200-11-250UG | 250UG |
| Human IL-16 (121 a.a.) | AF-200-16A-250UG | 250UG |
| Human IL-17A | AF-200-17-25UG | 25UG |
| Human IL-17F | AF-200-25-100UG | 100UG |
| Human IL-17F | AF-200-25-500UG | 500UG |
| Human IL-33 | AF-200-33-500UG | 500UG |
| Human IL-17F | AF-200-25-1MG | 1MG |
| Human IL-17D | AF-200-27-100UG | 100UG |
| Human IL-37 (IL-1F7) | AF-200-39-250UG | 250UG |
| Murine IL-21 | AF-210-21-2UG | 2UG |
| Murine IL-22 | AF-210-22-100UG | 100UG |
| Murine IL-6 | AF-216-16-50UG | 50UG |
| Murine BD-3 | AF-250-41-5UG | 5UG |
| Human IFN-gamma | AF-300-02-250UG | 250UG |
| Human GM-CSF | AF-300-03-100UG | 100UG |
| Human RANTES (CCL5) | AF-300-06-100UG | 100UG |
| Human SCF | AF-300-07-250UG | 250UG |
| Human RANTES (CCL5) | AF-300-06-1MG | 1MG |
| Animal-Free Recombinant Human Oncostatin M (209 a.a.) | AF-300-10T-100UG | 100UG |
| Human GRO-alpha/MGSA (CXCL1) | AF-300-11-500UG | 500UG |
| Human TPO | AF-300-18-2UG | 2UG |
| Human G-CSF | AF-300-23-2UG | 2UG |
| Human G-CSF | AF-300-23-1MG | 1MG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-50UG | 50UG |
| Human TECK (CCL25) | AF-300-45-5UG | 5UG |
| Human I-TAC (CXCL11) | AF-300-46-1MG | 1MG |
| Human C5a | AF-300-70-1MG | 1MG |
| Human sTNF Receptor Type I | AF-310-07-250UG | 250UG |
| Human BAFF | AF-310-13-1MG | 1MG |
| Human TL-1A | AF-310-23-20UG | 20UG |
| Murine M-CSF | AF-315-02-2UG | 2UG |
| Murine IFN-gamma | AF-315-05-100UG | 100UG |
| Murine GM-CSF | AF-315-03-500UG | 500UG |
| Murine LIGHT | AF-315-12-5UG | 5UG |
| Human Enterokinase | AF-450-48C-250UG | 250UG |
| Anti-Human IL-7 (Monoclonal Mouse) | 500-M07-500UG | 500UG |
| Anti-Human TNF-alpha (Monoclonal Mouse) | 500-M26-500UG | 500UG |
| Anti-Human SCF (Monoclonal Mouse) | 500-M44-500UG | 500UG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03-50UG | 50UG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03G-1MG | 1MG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-16 | 500-P06Bt-50UG | 50UG |
| Anti-Human IL-17A (Polyclonal Goat) | 500-P07G-50UG | 50UG |
| Anti-Human IL-13 | 500-P13-1MG | 1MG |
| Biotinylated Anti-Human IL-13 | 500-P13Bt-1MG | 1MG |
| Anti-Human IL-2 (Polyclonal Goat) | 500-P22G-50UG | 50UG |
| Biotinylated Anti-Human IL-1beta | 500-P21BGBt-50UG | 50UG |
| Biotinylated Anti-Human sIL-2 Receptor alpha | 500-P22RBt-50UG | 50UG |
| Anti-Human IL-5 | 500-P25-1MG | 1MG |
| Anti-Human IL-6 (Polyclonal Goat) | 500-P26G-1MG | 1MG |
| Biotinylated Anti-Human IL-9 | 500-P29Bt-25UG | 25UG |
| Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AG-50UG | 50UG |
| Biotinylated Anti-Human TNF-beta | 500-P31BBt-1MG | 1MG |
| Anti-Human GM-CSF | 500-P33-1MG | 1MG |
| Anti-Human RANTES (CCL5) | 500-P36-100UG | 100UG |
| Biotinylated Anti-Human Lymphotactin (XCL1) | 500-P40Bt-25UG | 25UG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41-1MG | 1MG |
| Anti-Human M-CSF | 500-P44-100UG | 100UG |
| Biotinylated Anti-Human M-CSF | 500-P44Bt-1MG | 1MG |
| Anti-Human SCF (Polyclonal Rabbit) | 500-P48-50UG | 50UG |
| Murine TNF-alpha | AF-315-01A-500UG | 500UG |
| Murine LIGHT | AF-315-12-100UG | 100UG |
| Murine TPO | AF-315-14-500UG | 500UG |
| Rat IL-2 | AF-400-02-20UG | 20UG |
| Rat M-CSF | AF-400-28-1MG | 1MG |
| Anti-Human IL-12 (Monoclonal Mouse) | 500-M12-500UG | 500UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04G-1MG | 1MG |
| Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07-100UG | 100UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Goat) | 500-P07GBt-50UG | 50UG |
| Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10G-100UG | 100UG |
| Biotinylated Anti-Human IL-13 | 500-P13Bt-50UG | 50UG |
| Biotinylated Anti-Human TGF-alpha | 500-P16Bt-25UG | 25UG |
| Anti-Human IL-10 | 500-P20-100UG | 100UG |
| Biotinylated Anti-Human IL-10 | 500-P20Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-6 (Polyclonal Rabbit) | 500-P26Bt-25UG | 25UG |
| Anti-Human IL-7 | 500-P27-50UG | 50UG |
| Biotinylated Anti-Human IL-6 (Polyclonal Goat) | 500-P26GBt-50UG | 50UG |
| Anti-Human Oncostatin M | 500-P30-100UG | 100UG |
| Anti-Human IFN-beta | 500-P32B-100UG | 100UG |
| Anti-Human GM-CSF | 500-P33-100UG | 100UG |
| Biotinylated Anti-Human MCP-1 (CCL2) | 500-P34Bt-50UG | 50UG |
| Biotinylated Anti-Human RANTES (CCL5) | 500-P36Bt-50UG | 50UG |
| Biotinylated Anti-Human MCP-3 (CCL7) | 500-P37GBt-1MG | 1MG |
| Biotinylated Anti-Human MIP-1alpha (CCL3) (Polyclonal Rabbit) | 500-P38Bt-1MG | 1MG |
| Anti-Human Lymphotactin (XCL1) | 500-P40-1MG | 1MG |
| Anti-Human G-CSF | 500-P43-100UG | 100UG |
| Biotinylated Anti-Human G-CSF | 500-P43Bt-1MG | 1MG |
| Biotinylated Anti-Human M-CSF | 500-P44Bt-50UG | 50UG |
| Anti-Human EGF | 500-P45-100UG | 100UG |
| Murine GM-CSF | AF-315-03-1MG | 1MG |
| Murine IFN-gamma | AF-315-05-250UG | 250UG |
| Murine TPO | AF-315-14-100UG | 100UG |
| Murine TPO | AF-315-14-1MG | 1MG |
| Rat M-CSF | AF-400-28-50UG | 50UG |
| Rat TPO | AF-400-34-1MG | 1MG |
| Rat M-CSF | AF-400-28-250UG | 250UG |
| Human Enterokinase | AF-450-48C-10UG | 10UG |
| Anti-Human Eotaxin (CCL11) (Monoclonal Mouse) | 500-M25-500UG | 500UG |
| Anti-Human MIG (CXCL9) (Monoclonal Mouse) | 500-M42-500UG | 500UG |
| Anti-Human MCP-1 (CCL2) (Monoclonal Mouse) | 500-M71-500UG | 500UG |
| Anti-Human Adiponectin (Monoclonal Mouse) | 500-M126-500UG | 500UG |
| Biotinylated Anti-Human IL-11 | 500-P01Bt-25UG | 25UG |
| Anti-Human IL-11 | 500-P01-100UG | 100UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03GBt-25UG | 25UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03GBt-1MG | 1MG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04GBt-25UG | 25UG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04GBt-1MG | 1MG |
| Biotinylated Anti-Human IL-16 | 500-P06Bt-1MG | 1MG |
| Anti-Human IL-17A (Polyclonal Goat) | 500-P07G-1MG | 1MG |
| Anti-Human IGF-II | 500-P12-1MG | 1MG |
| Biotinylated Anti-Human IL-13 | 500-P13Bt-25UG | 25UG |
| Anti-Human IGF-II | 500-P12-50UG | 50UG |
| Biotinylated Anti-Human IGF-II | 500-P12Bt-1MG | 1MG |
| Anti-Human FGF-acidic | 500-P17-50UG | 50UG |
| Biotinylated Anti-Human KGF (FGF-7) | 500-P19Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-2 (Polyclonal Goat) | 500-P22GBt-50UG | 50UG |
| Biotinylated Anti-Human IL-8 (CXCL8) | 500-P28Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-8 (CXCL8) | 500-P28Bt-25UG | 25UG |
| Biotinylated Anti-Human Oncostatin M | 500-P30Bt-50UG | 50UG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31ABt-25UG | 25UG |
| Anti-Human TNF-beta | 500-P31B-100UG | 100UG |
| Biotinylated Anti-Human IFN-gamma | 500-P32Bt-1MG | 1MG |
| Biotinylated Anti-Human GM-CSF | 500-P33Bt-25UG | 25UG |
| Anti-Human MCP-1 (CCL2) | 500-P34-50UG | 50UG |
| Anti-Human MIP-1alpha (CCL3) (Polyclonal Rabbit) | 500-P38-100UG | 100UG |
| Biotinylated Anti-Human MCP-3 (CCL7) | 500-P37GBt-50UG | 50UG |
| Biotinylated Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41Bt-1MG | 1MG |
| Anti-Human M-CSF | 500-P44-1MG | 1MG |
| Anti-Human SCF (Polyclonal Rabbit) | 500-P48-1MG | 1MG |
| Biotinylated Anti-Human TPO (Polyclonal Goat) | 500-P49GBt-25UG | 25UG |
| Murine TPO | AF-315-14-2UG | 2UG |
| Rat SCF | AF-400-22-1MG | 1MG |
| Human NT-4 | AF-450-04-1MG | 1MG |
| Human Artemin | AF-450-17-50UG | 50UG |
| Human Artemin | AF-450-17-100UG | 100UG |
| Anti-Human FGF-basic (Monoclonal Mouse) | 500-M38C-500UG | 500UG |
| Anti-Human sTRAIL/Apo2L (Monoclonal Mouse) | 500-M49-500UG | 500UG |
| Anti-Murine IL-12 (Monoclonal Rat) | 500-M59-500UG | 500UG |
| Anti-Human MCP-3 (CCL7) (Monoclonal Mouse) | 500-M73-500UG | 500UG |
| Anti-Human IFN-gamma (Monoclonal Mouse) | 500-M90-500UG | 500UG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03-1MG | 1MG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04Bt-50UG | 50UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04G-100UG | 100UG |
| Biotinylated Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04GBt-50UG | 50UG |
| Anti-Human PF-4 (CXCL4) | 500-P05-50UG | 50UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07Bt-50UG | 50UG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10Bt-1MG | 1MG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10GBt-25UG | 25UG |
| Anti-Human IL-15 | 500-P15-1MG | 1MG |
| Anti-Human IL-15 | 500-P15-50UG | 50UG |
| Anti-Human FGF-basic | 500-P18-50UG | 50UG |
| Anti-Human IL-2 (Polyclonal Goat) | 500-P22G-100UG | 100UG |
| Anti-Human IL-5 | 500-P25-50UG | 50UG |
| Anti-Human IL-4 | 500-P24-1MG | 1MG |
| Anti-Human Oncostatin M | 500-P30-1MG | 1MG |
| Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AG-100UG | 100UG |
| Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31A-50UG | 50UG |
| Anti-Human TNF-beta | 500-P31B-1MG | 1MG |
| Anti-Human IFN-gamma | 500-P32-100UG | 100UG |
| Anti-Human GM-CSF | 500-P33-50UG | 50UG |
| Biotinylated Anti-Human MCP-1 (CCL2) | 500-P34Bt-25UG | 25UG |
| Anti-Human MIP-1beta (CCL4) | 500-P38B-100UG | 100UG |
| Biotinylated Anti-Human MCP-3 (CCL7) | 500-P37GBt-25UG | 25UG |
| Anti-Human LIF | 500-P39-100UG | 100UG |
| Anti-Human Lymphotactin (XCL1) | 500-P40-100UG | 100UG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Goat) | 500-P41G-1MG | 1MG |
| Biotinylated Anti-Human Eotaxin (CCL11) (Polyclonal Goat) | 500-P41GBt-1MG | 1MG |
| Biotinylated Anti-Human Flt3-Ligand | 500-P42Bt-25UG | 25UG |
| Biotinylated Anti-Human SCF (Polyclonal Rabbit) | 500-P48Bt-50UG | 50UG |
| Anti-Human SCF (Polyclonal Rabbit) | 500-P48-100UG | 100UG |
| Anti-Murine IL-1beta | 500-P51-50UG | 50UG |
| Biotinylated Anti-Murine IL-1beta | 500-P51Bt-25UG | 25UG |
| Anti-Murine IL-9 | 500-P59-1MG | 1MG |
| Biotinylated Anti-Murine MCP-5 (CCL12) | 500-P61Bt-25UG | 25UG |
| Anti-Murine TNF-alpha (Polyclonal Rabbit) | 500-P64-1MG | 1MG |
| Anti-Murine FGF-9 | 500-P66-100UG | 100UG |
| Anti-Murine Leptin | 500-P68-50UG | 50UG |
| Anti-Murine G-CSF | 500-P69-50UG | 50UG |
| Anti-Murine G-CSF | 500-P69-100UG | 100UG |
| Biotinylated Anti-Rat IL-6 (Polyclonal Goat) | 500-P73GBt-1MG | 1MG |
| Biotinylated Anti-Rat RANTES (CCL5) | 500-P78Bt-25UG | 25UG |
| Anti-Rat RANTES (CCL5) | 500-P78-100UG | 100UG |
| Anti-Human NT-3 (Polyclonal Rabbit) | 500-P82-50UG | 50UG |
| Anti-Human/Murine/Rat BDNF | 500-P84-100UG | 100UG |
| Biotinylated Anti-Human SDF-1alpha (CXCL12) | 500-P87ABt-1MG | 1MG |
| Anti-Human IL-17D | 500-P88-50UG | 50UG |
| Anti-Human IL-17E | 500-P89-50UG | 50UG |
| Biotinylated Anti-Human ENA-78 (CXCL5) | 500-P91Bt-1MG | 1MG |
| Biotinylated Anti-Human IP-10 (CXCL10) | 500-P93Bt-1MG | 1MG |
| Biotinylated Anti-Rat IL-4 | 500-P94Bt-25UG | 25UG |
| Anti-Human SCGF-beta | 500-P99G-100UG | 100UG |
| Biotinylated Anti-Human SCGF-beta | 500-P99GBt-1MG | 1MG |
| Biotinylated Anti-Human Neurturin | 500-P102Bt-1MG | 1MG |
| Anti-Human GRO-gamma (CXCL3) | 500-P105-1MG | 1MG |
| Biotinylated Anti-Human Exodus-2 (CCL21) | 500-P109Bt-50UG | 50UG |
| Biotinylated Anti-Human MIP-4 (CCL18) | 500-P108Bt-1MG | 1MG |
| Biotinylated Anti-Murine JE/MCP-1 (CCL2) | 500-P113Bt-25UG | 25UG |
| Biotinylated Anti-Murine C10 (CCL6) | 500-P112Bt-1MG | 1MG |
| Anti-Murine MCP-3 (CCL7) | 500-P116G-50UG | 50UG |
| Biotinylated Anti-Murine MIP-1alpha (CCL3) | 500-P121Bt-50UG | 50UG |
| Anti-Rat IFN-gamma (Polyclonal Rabbit) | 500-P122-50UG | 50UG |
| Biotinylated Anti-Human MIP-3 (CCL23) | 500-P124Bt-1MG | 1MG |
| Anti-Human NP-1 | 500-P126G-50UG | 50UG |
| Biotinylated Anti-Human NP-1 | 500-P126GBt-1MG | 1MG |
| Anti-Murine MIP-2 (CXCL2) | 500-P130-100UG | 100UG |
| Biotinylated Anti-Murine MCP-2 (CCL8) | 500-P127Bt-50UG | 50UG |
| Anti-Murine VEGF 165 | 500-P131-1MG | 1MG |
| Biotinylated Anti-Murine VEGF 165 | 500-P131Bt-50UG | 50UG |
| Biotinylated Anti-Human TWEAK | 500-P137GBt-1MG | 1MG |
| Anti-Murine IL-3 | 500-P53-100UG | 100UG |
| Biotinylated Anti-Murine IL-4 | 500-P54Bt-50UG | 50UG |
| Anti-Murine IL-5 | 500-P55-1MG | 1MG |
| Biotinylated Anti-Murine MCP-5 (CCL12) | 500-P61Bt-50UG | 50UG |
| Biotinylated Anti-Murine MCP-5 (CCL12) | 500-P61Bt-1MG | 1MG |
| Anti-Murine sRANK Ligand | 500-P63-50UG | 50UG |
| Biotinylated Anti-Murine GM-CSF | 500-P65Bt-25UG | 25UG |
| Anti-Murine FGF-9 | 500-P66-50UG | 50UG |
| Biotinylated Anti-Murine Eotaxin (CCL11) | 500-P67Bt-50UG | 50UG |
| Biotinylated Anti-Murine SCF | 500-P71Bt-25UG | 25UG |
| Biotinylated Anti-Rat IL-6 (Polyclonal Rabbit) | 500-P73Bt-1MG | 1MG |
| Biotinylated Anti-Rat GRO/KC (CXCL1) | 500-P74Bt-50UG | 50UG |
| Anti-Rat MCP-1 (CCL2) | 500-P76-1MG | 1MG |
| Biotinylated Anti-Human NT-3 (Polyclonal Rabbit) | 500-P82Bt-25UG | 25UG |
| Anti-Human/Murine/Rat BDNF | 500-P84-1MG | 1MG |
| Biotinylated Anti-Human NT-4 | 500-P83GBt-1MG | 1MG |
| Biotinylated Anti-Human SDF-1alpha (CXCL12) | 500-P87ABt-50UG | 50UG |
| Anti-Human IL-17E | 500-P89-100UG | 100UG |
| Biotinylated Anti-Human IL-17E | 500-P89Bt-50UG | 50UG |
| Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92-100UG | 100UG |
| Anti-Human MIP-3alpha (CCL20) | 500-P95A-50UG | 50UG |
| Biotinylated Anti-Murine IL-2 | 500-P111Bt-50UG | 50UG |
| Anti-Murine Exodus-2 (CCL21) | 500-P114-100UG | 100UG |
| Biotinylated Anti-Murine MIP-1gamma (CCL9/10) | 500-P117Bt-1MG | 1MG |
| Anti-Human GCP-2 (CXCL6) | 500-P120-50UG | 50UG |
| Biotinylated Anti-Human GCP-2 (CXCL6) | 500-P120Bt-50UG | 50UG |
| Biotinylated Anti-Human GCP-2 (CXCL6) | 500-P120Bt-1MG | 1MG |
| Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122G-50UG | 50UG |
| Biotinylated Anti-Human MIP-3 (CCL23) | 500-P124Bt-25UG | 25UG |
| Biotinylated Anti-Human LEC (CCL16) | 500-P125GBt-50UG | 50UG |
| Anti-Murine MCP-2 (CCL8) | 500-P127-100UG | 100UG |
| Biotinylated Anti-Murine MIP-2 (CXCL2) | 500-P130Bt-1MG | 1MG |
| Anti-Murine VEGF 165 | 500-P131-50UG | 50UG |
| Anti-Human sRANK Ligand (Polyclonal Rabbit) | 500-P133-1MG | 1MG |
| Anti-Human sTRAIL/Apo2L | 500-P135-1MG | 1MG |
| Anti-Human BCA-1 (CXCL13) | 500-P141-100UG | 100UG |
| Biotinylated Anti-Human sTNF Receptor Type I | 500-P143Bt-1MG | 1MG |
| Biotinylated Anti-Murine LIX (CXCL6) | 500-P146Bt-50UG | 50UG |
| Anti-Human MIG (CXCL9) | 500-P50-1MG | 1MG |
| Biotinylated Anti-Murine IL-3 | 500-P53Bt-50UG | 50UG |
| Anti-Murine IL-5 | 500-P55-50UG | 50UG |
| Anti-Murine IL-5 | 500-P55-100UG | 100UG |
| Biotinylated Anti-Murine IL-5 | 500-P55Bt-50UG | 50UG |
| Anti-Murine MCP-5 (CCL12) | 500-P61-1MG | 1MG |
| Biotinylated Anti-Murine M-CSF | 500-P62GBt-50UG | 50UG |
| Anti-Murine TNF-alpha (Polyclonal Rabbit) | 500-P64-100UG | 100UG |
| Biotinylated Anti-Murine TNF-alpha (Polyclonal Goat) | 500-P64GBt-50UG | 50UG |
| Biotinylated Anti-Murine G-CSF | 500-P69Bt-25UG | 25UG |
| Biotinylated Anti-Rat IL-6 (Polyclonal Rabbit) | 500-P73Bt-50UG | 50UG |
| Anti-Rat GRO/KC (CXCL1) | 500-P74-100UG | 100UG |
| Biotinylated Anti-Rat GRO-beta/MIP-2 (CXCL2) | 500-P75Bt-25UG | 25UG |
| Biotinylated Anti-Rat MCP-1 (CCL2) | 500-P76Bt-25UG | 25UG |
| Biotinylated Anti-Rat GRO-beta/MIP-2 (CXCL2) | 500-P75Bt-1MG | 1MG |
| Anti-Rat MIP-1alpha (CCL3) | 500-P77-1MG | 1MG |
| Anti-Rat IL-1beta | 500-P80-50UG | 50UG |
| Biotinylated Anti-Rat IL-1beta | 500-P80Bt-25UG | 25UG |
| Anti-Human NT-4 | 500-P83G-1MG | 1MG |
| Anti-Human/Murine/Rat BDNF | 500-P84-50UG | 50UG |
| Anti-Human Leptin | 500-P86-50UG | 50UG |
| Biotinylated Anti-Human SDF-1beta (CXCL12) | 500-P87BGBt-50UG | 50UG |
| Anti-Human ENA-78 (CXCL5) | 500-P91-1MG | 1MG |
| Biotinylated Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92Bt-50UG | 50UG |
| Anti-Human MIP-3beta (CCL19) | 500-P95B-1MG | 1MG |
| Anti-Human SCGF-beta | 500-P99G-1MG | 1MG |
| Biotinylated Anti-Human Eotaxin-2 (CCL24) | 500-P103GBt-50UG | 50UG |
| Anti-Human GRO-beta (CXCL2) | 500-P104-1MG | 1MG |
| Biotinylated Anti-Human HCC-1 (CCL14) | 500-P106Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-2 | 500-P111Bt-25UG | 25UG |
| Biotinylated Anti-Murine JE/MCP-1 (CCL2) | 500-P113Bt-1MG | 1MG |
| Anti-Murine KC (CXCL1) | 500-P115-100UG | 100UG |
| Biotinylated Anti-Murine MIP-1gamma (CCL9/10) | 500-P117Bt-50UG | 50UG |
| Biotinylated Anti-Murine RANTES (CCL5) | 500-P118Bt-50UG | 50UG |
| Biotinylated Anti-Human IGF-I | 500-P11Bt-1MG | 1MG |
| Anti-Murine MCP-2 (CCL8) | 500-P127-50UG | 50UG |
| Anti-Murine IP-10 (CXCL10) | 500-P129-50UG | 50UG |
| Biotinylated Anti-Murine MIP-2 (CXCL2) | 500-P130Bt-50UG | 50UG |
| Anti-Human I-TAC (CXCL11) | 500-P132-50UG | 50UG |
| Biotinylated Anti-Human sRANK Ligand (Polyclonal Rabbit) | 500-P133Bt-1MG | 1MG |
| Biotinylated Anti-Human sTRAIL/Apo2L | 500-P135Bt-25UG | 25UG |
| Anti-Rat IL-10 | 500-P139-50UG | 50UG |
| Biotinylated Anti-Rat IL-10 | 500-P139Bt-50UG | 50UG |
| Anti-Human BCA-1 (CXCL13) | 500-P141-1MG | 1MG |
| Anti-Human FGF-17 (Polyclonal Rabbit) | 500-P152-100UG | 100UG |
| Anti-Human FGF-17 (Polyclonal Goat) | 500-P152G-1MG | 1MG |
| Biotinylated Anti-Human FGF-17 (Polyclonal Goat) | 500-P152GBt-1MG | 1MG |
| Anti-Human TPO (Polyclonal Goat) | 500-P49G-50UG | 50UG |
| Biotinylated Anti-Human TPO (Polyclonal Goat) | 500-P49GBt-1MG | 1MG |
| Anti-Murine IL-4 | 500-P54-50UG | 50UG |
| Anti-Murine IL-6 | 500-P56-50UG | 50UG |
| Anti-Murine MCP-5 (CCL12) | 500-P61-100UG | 100UG |
| Biotinylated Anti-Murine IL-10 | 500-P60Bt-25UG | 25UG |
| Anti-Murine M-CSF | 500-P62G-50UG | 50UG |
| Biotinylated Anti-Murine M-CSF | 500-P62GBt-1MG | 1MG |
| Anti-Murine sRANK Ligand | 500-P63-100UG | 100UG |
| Anti-Murine TNF-alpha (Polyclonal Goat) | 500-P64G-100UG | 100UG |
| Anti-Murine FGF-9 | 500-P66-1MG | 1MG |
| Biotinylated Anti-Murine SCF | 500-P71Bt-50UG | 50UG |
| Biotinylated Anti-Rat GRO/KC (CXCL1) | 500-P74Bt-1MG | 1MG |
| Anti-Rat MCP-1 (CCL2) | 500-P76-100UG | 100UG |
| Biotinylated Anti-Rat CNTF | 500-P79Bt-50UG | 50UG |
| Biotinylated Anti-Rat IL-1beta | 500-P80Bt-1MG | 1MG |
| Biotinylated Anti-Human beta-NGF | 500-P85Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-17D | 500-P88Bt-1MG | 1MG |
| Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92-50UG | 50UG |
| Anti-Human IP-10 (CXCL10) | 500-P93-50UG | 50UG |
| Anti-Rat IL-4 | 500-P94-1MG | 1MG |
| Anti-Human MIP-3alpha (CCL20) | 500-P95A-100UG | 100UG |
| Biotinylated Anti-Human Fractalkine (CX3CL1) | 500-P98Bt-25UG | 25UG |
| Anti-Human GRO-beta (CXCL2) | 500-P104-50UG | 50UG |
| Anti-Human HCC-1 (CCL14) | 500-P106-50UG | 50UG |
| Anti-Human MDC (CCL22) | 500-P107-50UG | 50UG |
| Biotinylated Anti-Human Exodus-2 (CCL21) | 500-P109Bt-1MG | 1MG |
| Biotinylated Anti-Murine Exodus-2 (CCL21) | 500-P114Bt-25UG | 25UG |
| Biotinylated Anti-Murine KC (CXCL1) | 500-P115Bt-25UG | 25UG |
| Biotinylated Anti-Murine MCP-3 (CCL7) | 500-P116GBt-50UG | 50UG |
| Biotinylated Anti-Murine MIP-1gamma (CCL9/10) | 500-P117Bt-25UG | 25UG |
| Anti-Murine IFN-gamma | 500-P119-1MG | 1MG |
| Anti-Murine IFN-gamma | 500-P119-50UG | 50UG |
| Anti-Murine MIP-1alpha (CCL3) | 500-P121-100UG | 100UG |
| Anti-Rat IFN-gamma (Polyclonal Rabbit) | 500-P122-1MG | 1MG |
| Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122G-100UG | 100UG |
| Anti-Human MIP-5 (CCL15) | 500-P123G-1MG | 1MG |
| Biotinylated Anti-Human MIP-5 (CCL15) | 500-P123GBt-50UG | 50UG |
| Anti-Murine MCP-2 (CCL8) | 500-P127-1MG | 1MG |
| Anti-Murine MIP-2 (CXCL2) | 500-P130-50UG | 50UG |
| Anti-Murine VEGF 165 | 500-P131-100UG | 100UG |
| Biotinylated Anti-Murine VEGF 165 | 500-P131Bt-25UG | 25UG |
| Biotinylated Anti-Human I-TAC (CXCL11) | 500-P132Bt-1MG | 1MG |
| Biotinylated Anti-Murine VEGF 165 | 500-P131Bt-1MG | 1MG |
| Anti-Human sRANK Ligand (Polyclonal Goat) | 500-P133G-100UG | 100UG |
| Biotinylated Anti-Human Persephin | 500-P138Bt-25UG | 25UG |
| Biotinylated Anti-Human BCA-1 (CXCL13) | 500-P141Bt-25UG | 25UG |
| Anti-Human sRANK Receptor | 500-P144-50UG | 50UG |
| Anti-Murine LIX (CXCL6) | 500-P146-100UG | 100UG |
| Anti-Human FGF-17 (Polyclonal Goat) | 500-P152G-100UG | 100UG |
| Biotinylated Anti-Human FGF-17 (Polyclonal Goat) | 500-P152GBt-50UG | 50UG |
| Biotinylated Anti-Human FGF-17 (Polyclonal Goat) | 500-P152GBt-25UG | 25UG |
| Anti-Murine IL-18BP | 500-P153G-50UG | 50UG |
| Anti-Human FGF-17 (Polyclonal Rabbit) | 500-P152-1MG | 1MG |
| Anti-Human IL-12 | 500-P154G-100UG | 100UG |
| Biotinylated Anti-Human IL-12 | 500-P154GBt-1MG | 1MG |
| Biotinylated Anti-Murine IGF-I | 500-P157GBt-25UG | 25UG |
| Biotinylated Anti-Human Eotaxin-3 (CCL26) | 500-P156GBt-1MG | 1MG |
| Biotinylated Anti-Human FGF-4 | 500-P158Bt-1MG | 1MG |
| Biotinylated Anti-Human BD-2 | 500-P161GBt-25UG | 25UG |
| Biotinylated Anti-Human BAFF (Polyclonal Rabbit) | 500-P163BT-25UG | 25UG |
| Biotinylated Anti-Human 4-1BB Ligand | 500-P169Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-15 | 500-P173Bt-50UG | 50UG |
| Anti-Murine Eotaxin-2 (CCL24) | 500-P175G-50UG | 50UG |
| Biotinylated Anti-Murine Eotaxin-2 (CCL24) | 500-P175GBt-50UG | 50UG |
| Biotinylated Anti-Rat IL-3beta | 500-P177GBt-50UG | 50UG |
| Biotinylated Anti-Human LIGHT | 500-P179Bt-50UG | 50UG |
| Biotinylated Anti-Murine IL-13 | 500-P178Bt-1MG | 1MG |
| Anti-Human Resistin (Polyclonal Rabbit) | 500-P183-100UG | 100UG |
| Anti-Human sFas Ligand | 500-P184G-100UG | 100UG |
| Biotinylated Anti-Human LD78beta (CCL3L1) | 500-P187GBt-1MG | 1MG |
| Biotinylated Anti-Human EG-VEGF | 500-P188GBt-50UG | 50UG |
| Anti-Human IL-19 | 500-P189-1MG | 1MG |
| Anti-Human IL-21 | 500-P191-1MG | 1MG |
| Biotinylated Anti-Human APRIL | 500-P192Bt-50UG | 50UG |
| Anti-Human/Murine/Rat BMP-2 | 500-P195-100UG | 100UG |
| Anti-Human CXCL16 | 500-P200-50UG | 50UG |
| Biotinylated Anti-Human CXCL16 | 500-P200Bt-1MG | 1MG |
| Anti-Rat SCF | 500-P202-100UG | 100UG |
| Biotinylated Anti-Human gAcrp30/Adipolean Variant | 500-P205Bt-25UG | 25UG |
| Biotinylated Anti-Murine RELMalpha | 500-P214Bt-50UG | 50UG |
| Biotinylated Anti-Human RELMbeta | 500-P217Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-22 | 500-P223Bt-1MG | 1MG |
| Anti-Rat IL-13 | 500-P224-1MG | 1MG |
| Biotinylated Anti-Rat IL-13 | 500-P224Bt-50UG | 50UG |
| Anti-Human PlGF-1 | 500-P226-100UG | 100UG |
| Anti-Human IGF-BP1 | 500-P228-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP1 | 500-P228Bt-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP5 | 500-P232Bt-50UG | 50UG |
| Biotinylated Anti-Human GDF-3 | 500-P235Bt-50UG | 50UG |
| Anti-Human BRAK (CXCL14) | 500-P237-100UG | 100UG |
| Biotinylated Anti-Human ApoE3 | 500-P238Bt-50UG | 50UG |
| Biotinylated Anti-Human TL-1A | 500-P240Bt-1MG | 1MG |
| Anti-Human TL-1A | 500-P240-1MG | 1MG |
| Anti-Human Artemin | 500-P245-100UG | 100UG |
| Biotinylated Anti-Human Galectin-3 | 500-P246Bt-25UG | 25UG |
| Biotinylated Anti-Human Artemin | 500-P245Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-17B | 500-P248Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-17B | 500-P248Bt-1MG | 1MG |
| Biotinylated Anti-Human IFN-lambda2 | 500-P247Bt-1MG | 1MG |
| Anti-Human Wnt-3a | 500-P251-100UG | 100UG |
| Anti-Human BD-1 | 500-P253-50UG | 50UG |
| Anti-Human BD-1 | 500-P253-1MG | 1MG |
| Biotinylated Anti-Human BD-1 | 500-P253Bt-1MG | 1MG |
| Anti-Human IL-12 | 500-P154G-1MG | 1MG |
| Biotinylated Anti-Human IL-12 | 500-P154GBt-25UG | 25UG |
| Biotinylated Anti-Murine IL-12 | 500-P155GBt-50UG | 50UG |
| Anti-Human FGF-4 | 500-P158-50UG | 50UG |
| Biotinylated Anti-Human IL-15 | 500-P15Bt-1MG | 1MG |
| Biotinylated Anti-Human BD-2 | 500-P161GBt-50UG | 50UG |
| Biotinylated Anti-Human SCGF-alpha | 500-P162BT-50UG | 50UG |
| Biotinylated Anti-Human BAFF (Polyclonal Goat) | 500-P163GBt-1MG | 1MG |
| Biotinylated Anti-Murine SDF-1alpha (CXCL12) | 500-P164GBt-25UG | 25UG |
| Biotinylated Anti-Human Midkine | 500-P171Bt-50UG | 50UG |
| Biotinylated Anti-Murine MDC (CCL22) | 500-P176Bt-25UG | 25UG |
| Anti-Rat IL-3beta | 500-P177G-100UG | 100UG |
| Biotinylated Anti-Rat IL-3beta | 500-P177GBt-1MG | 1MG |
| Anti-Murine IL-13 | 500-P178-1MG | 1MG |
| Biotinylated Anti-Human FGF-acidic | 500-P17Bt-1MG | 1MG |
| Biotinylated Anti-Rat IL-1alpha | 500-P180GBt-50UG | 50UG |
| Anti-Human Resistin (Polyclonal Rabbit) | 500-P183-1MG | 1MG |
| Anti-Murine Resistin | 500-P182G-100UG | 100UG |
| Biotinylated Anti-Murine Resistin | 500-P182GBt-50UG | 50UG |
| Anti-Human Resistin (Polyclonal Goat) | 500-P183G-1MG | 1MG |
| Anti-Human sFas Ligand | 500-P184G-1MG | 1MG |
| Anti-Rat Leptin | 500-P185G-1MG | 1MG |
| Biotinylated Anti-Human NNT-1/BCSF-3 | 500-P186Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-21 | 500-P191Bt-25UG | 25UG |
| Anti-Human gAcrp30/Adipolean | 500-P193G-50UG | 50UG |
| Biotinylated Anti-Human/Murine/Rat BMP-2 | 500-P195Bt-1MG | 1MG |
| Biotinylated Anti-Murine CXCL16 | 500-P201GBt-25UG | 25UG |
| Anti-Rat SCF | 500-P202-1MG | 1MG |
| Anti-Human IL-22 | 500-P211-50UG | 50UG |
| Anti-Human GDF-3 | 500-P235-50UG | 50UG |
| Biotinylated Anti-Human Nanog | 500-P236Bt-25UG | 25UG |
| Biotinylated Anti-Human BRAK (CXCL14) | 500-P237Bt-25UG | 25UG |
| Biotinylated Anti-Human MIA | 500-P243Bt-25UG | 25UG |
| Biotinylated Anti-Human Artemin | 500-P245Bt-25UG | 25UG |
| Biotinylated Anti-Human Galectin-3 | 500-P246Bt-50UG | 50UG |
| Anti-Human IL-17B | 500-P248-1MG | 1MG |
| Biotinylated Anti-Human IL-17B | 500-P248Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-31 | 500-P249Bt-50UG | 50UG |
| Biotinylated Anti-Human Wnt-1 | 500-P250Bt-50UG | 50UG |
| Biotinylated Anti-Murine IL-12 | 500-P155GBt-25UG | 25UG |
| Anti-Murine IL-12 | 500-P155G-1MG | 1MG |
| Anti-Human Eotaxin-3 (CCL26) | 500-P156G-1MG | 1MG |
| Biotinylated Anti-Human Eotaxin-3 (CCL26) | 500-P156GBt-50UG | 50UG |
| Biotinylated Anti-Human SCGF-alpha | 500-P162BT-25UG | 25UG |
| Anti-Human BAFF (Polyclonal Goat) | 500-P163G-50UG | 50UG |
| Anti-Human TACI | 500-P166G-100UG | 100UG |
| Biotinylated Anti-Human TACI | 500-P166GBt-50UG | 50UG |
| Biotinylated Anti-Human 4-1BB Receptor | 500-P167GBt-50UG | 50UG |
| Anti-Human 4-1BB Ligand | 500-P169-100UG | 100UG |
| Biotinylated Anti-Human 4-1BB Ligand | 500-P169Bt-50UG | 50UG |
| Anti-Human EMAP-II | 500-P172G-1MG | 1MG |
| Anti-Murine MDC (CCL22) | 500-P176-100UG | 100UG |
| Biotinylated Anti-Human Resistin (Polyclonal Rabbit) | 500-P183Bt-25UG | 25UG |
| Anti-Human Resistin (Polyclonal Goat) | 500-P183G-50UG | 50UG |
| Anti-Human Resistin (Polyclonal Rabbit) | 500-P183-50UG | 50UG |
| Biotinylated Anti-Human LD78beta (CCL3L1) | 500-P187GBt-50UG | 50UG |
| Biotinylated Anti-Human LD78beta (CCL3L1) | 500-P187GBt-25UG | 25UG |
| Biotinylated Anti-Human APRIL | 500-P192Bt-25UG | 25UG |
| Anti-Human gAcrp30/Adipolean | 500-P193G-1MG | 1MG |
| Biotinylated Anti-Human CXCL16 | 500-P200Bt-25UG | 25UG |
| Anti-Murine CXCL16 | 500-P201G-100UG | 100UG |
| Biotinylated Anti-Rat SCF | 500-P202Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-1RA | 500-P209Bt-25UG | 25UG |
| Biotinylated Anti-Human Follistatin | 500-P207Bt-50UG | 50UG |
| Biotinylated Anti-Human Galectin-1 | 500-P210Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-22 | 500-P211Bt-1MG | 1MG |
| Biotinylated Anti-Human CTGFL/WISP-2 | 500-P212Bt-25UG | 25UG |
| Biotinylated Anti-Murine MIP-1beta (CCL4) | 500-P213Bt-1MG | 1MG |
| Anti-Murine RELMbeta | 500-P215-1MG | 1MG |
| Anti-Rat IL-13 | 500-P224-100UG | 100UG |
| Anti-Rat GM-CSF | 500-P225-50UG | 50UG |
| Anti-Rat GM-CSF | 500-P225-1MG | 1MG |
| Biotinylated Anti-Human PlGF-1 | 500-P226Bt-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP3 | 500-P230Bt-25UG | 25UG |
| Biotinylated Anti-Human GDF-3 | 500-P235Bt-25UG | 25UG |
| Anti-Human ApoE3 | 500-P238-100UG | 100UG |
| Anti-Human ApoE3 | 500-P238-1MG | 1MG |
| Biotinylated Anti-Human BD-3 | 500-P241Bt-1MG | 1MG |
| Biotinylated Anti-Human IFN-lambda2 | 500-P247Bt-25UG | 25UG |
| Anti-Human Wnt-1 | 500-P250-100UG | 100UG |
| Anti-Human Wnt-3a | 500-P251-50UG | 50UG |
| Biotinylated Anti-Human Eotaxin-3 (CCL26) | 500-P156GBt-25UG | 25UG |
| Biotinylated Anti-Human FGF-4 | 500-P158Bt-25UG | 25UG |
| Anti-Human BAFF (Polyclonal Rabbit) | 500-P163-50UG | 50UG |
| Biotinylated Anti-Human BAFF (Polyclonal Goat) | 500-P163GBt-50UG | 50UG |
| Anti-Murine SDF-1alpha (CXCL12) | 500-P164G-50UG | 50UG |
| Anti-Murine IL-15 | 500-P173-1MG | 1MG |
| Biotinylated Anti-Murine EGF | 500-P174GBt-50UG | 50UG |
| Anti-Murine IL-13 | 500-P178-50UG | 50UG |
| Biotinylated Anti-Human FGF-acidic | 500-P17Bt-50UG | 50UG |
| Biotinylated Anti-Human Resistin (Polyclonal Rabbit) | 500-P183Bt-1MG | 1MG |
| Biotinylated Anti-Human Resistin (Polyclonal Goat) | 500-P183GBt-1MG | 1MG |
| Biotinylated Anti-Human sFas Ligand | 500-P184GBt-1MG | 1MG |
| Biotinylated Anti-Rat Leptin | 500-P185GBt-50UG | 50UG |
| Anti-Human LD78beta (CCL3L1) | 500-P187G-50UG | 50UG |
| Biotinylated Anti-Human FGF-basic | 500-P18Bt-1MG | 1MG |
| Biotinylated Anti-Human APRIL | 500-P192Bt-1MG | 1MG |
| Biotinylated Anti-Human BMP-7 | 500-P198Bt-50UG | 50UG |
| Biotinylated Anti-Human CXCL16 | 500-P200Bt-50UG | 50UG |
| Anti-Human IL-1RA | 500-P209-50UG | 50UG |
| Anti-Human Galectin-1 | 500-P210-1MG | 1MG |
| Biotinylated Anti-Human Galectin-1 | 500-P210Bt-25UG | 25UG |
| Biotinylated Anti-Murine RELMbeta | 500-P215Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-22 | 500-P223Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-22 | 500-P223Bt-50UG | 50UG |
| Biotinylated Anti-Rat GM-CSF | 500-P225Bt-1MG | 1MG |
| Biotinylated Anti-Human PlGF-1 | 500-P226Bt-25UG | 25UG |
| Anti-Human IGF-BP3 | 500-P230-100UG | 100UG |
| Anti-Human IGF-BP3 | 500-P230-1MG | 1MG |
| Anti-Human GDF-3 | 500-P235-100UG | 100UG |
| Anti-Human GDF-3 | 500-P235-1MG | 1MG |
| Biotinylated Anti-Human Adiponectin | 500-P239BT-25UG | 25UG |
| Biotinylated Anti-Human ApoE3 | 500-P238Bt-1MG | 1MG |
| Biotinylated Anti-Human CRP | 500-P242BT-1MG | 1MG |
| Anti-Human Galectin-3 | 500-P246-50UG | 50UG |
| Biotinylated Anti-Human Galectin-3 | 500-P246Bt-1MG | 1MG |
| Biotinylated Anti-Human Artemin | 500-P245Bt-1MG | 1MG |
| Anti-Human Wnt-1 | 500-P250-50UG | 50UG |
| Biotinylated Anti-Human Wnt-3a | 500-P251Bt-1MG | 1MG |
| Biotinylated Anti-Human BD-1 | 500-P253Bt-25UG | 25UG |
| Biotinylated Anti-Human MIA-2 | 500-P255Bt-25UG | 25UG |
| Anti-Human TSLP | 500-P258-100UG | 100UG |
| Biotinylated Anti-Human IL-33 | 500-P261Bt-25UG | 25UG |
| Biotinylated Anti-Human Endostatin | 500-P262Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-17A | 500-P265Bt-50UG | 50UG |
| Anti-Human Maspin | 500-P270-50UG | 50UG |
| Biotinylated Anti-Human Neuroserpin | 500-P271Bt-1MG | 1MG |
| Biotinylated Anti-Rat VEGF 165 | 500-P275Bt-50UG | 50UG |
| Biotinylated Anti-Rat EGF | 500-P277Bt-25UG | 25UG |
| Biotinylated Anti-Human PTHrP | 500-P276Bt-25UG | 25UG |
| Biotinylated Anti-Human p16-INK4a-TAT | 500-P284TBt-50UG | 50UG |
| Anti-Human p16-INK4a-TAT | 500-P284T-1MG | 1MG |
| Anti-Human Heregulinbeta-1 | 500-P288-1MG | 1MG |
| Anti-Human sTRAIL Receptor-2 | 500-P299-100UG | 100UG |
| Anti-Murine TRAIL | 500-P303-1MG | 1MG |
| Biotinylated Anti-Human EGF Receptor (EGFR) | 500-P306Bt-1MG | 1MG |
| Anti-Human EGF Receptor (EGFR) | 500-P306-50UG | 50UG |
| Anti-Human Osteopontin | 500-P314-50UG | 50UG |
| Anti-Human Osteopontin | 500-P314-100UG | 100UG |
| Biotinylated Anti-Human TFF-2 | 500-P312Bt-50UG | 50UG |
| Anti-Human TGF-beta3 | 500-P317-50UG | 50UG |
| Biotinylated Anti-Human TGF-beta3 | 500-P317BT-1MG | 1MG |
| Anti-Human sCD14 | 500-P320-50UG | 50UG |
| Anti-Human BD-5 | 500-P323-50UG | 50UG |
| Anti-Human MMP-3 | 500-P324-1MG | 1MG |
| Biotinylated Anti-Human MMP-3 | 500-P324BT-1MG | 1MG |
| Anti-Human VAP-1 | 500-P326-50UG | 50UG |
| Anti-Human HB-EGF | 500-P329-50UG | 50UG |
| Biotinylated Anti-Human sCD34 | 500-P327BT-1MG | 1MG |
| Anti-Human ApoA-I | 500-P331-50UG | 50UG |
| Human VEGF 165 Standard ABTS ELISA Development Kit | 900-K10 | 1kit |
| Human GM-CSF Standard ABTS ELISA Development Kit | 900-K30 | 1kit |
| Murine IL-10 Standard ABTS ELISA Development Kit | 900-K53 | 1kit |
| Rat CNTF Standard ABTS ELISA Development Kit | 900-K65 | 1kit |
| Rat IL-6 Standard ABTS ELISA Development Kit | 900-K86 | 1kit |
| Murine Exodus-2 (CCL21) Standard ABTS ELISA Development Kit | 900-K132 | 1kit |
| Human CNTF Standard ABTS ELISA Development Kit | 900-K158 | 1kit |
| Murine MDC (CCL22) Standard ABTS ELISA Development Kit | 900-K197 | 1kit |
| Rat IL-2 Standard ABTS ELISA Development Kit | 900-K205 | 1kit |
| Murine sRANK Ligand Standard ABTS ELISA Development Kit | 900-K233 | 1kit |
| Human CTACK (CCL27) Standard ABTS ELISA Development Kit | 900-K213 | 1kit |
| Human IL-2 Mini ABTS ELISA Development Kit | 900-M12 | 1kit |
| Human IL-7 Mini ABTS ELISA Development Kit | 900-M17 | 1kit |
| Rat TNF-alpha Mini ABTS ELISA Development Kit | 900-M73 | 1kit |
| Human IL-1beta Mini ABTS ELISA Development Kit | 900-M95 | 1kit |
| Murine VEGF 165 Mini ABTS ELISA Development Kit | 900-M99 | 1kit |
| Human BD-2 Mini ABTS ELISA Development Kit | 900-M172 | 1kit |
| Anti-Human MIA-2 | 500-P255-50UG | 50UG |
| Biotinylated Anti-Human Vaspin | 500-P256Bt-50UG | 50UG |
| Biotinylated Anti-Murine SF-20 | 500-P259Bt-1MG | 1MG |
| Anti-Murine IL-17A | 500-P265-100UG | 100UG |
| Biotinylated Anti-Murine IL-17A | 500-P265Bt-1MG | 1MG |
| Anti-Murine IL-17A | 500-P265-1MG | 1MG |
| Anti-Human BD-4 | 500-P268-1MG | 1MG |
| Anti-Human BD-4 | 500-P268-100UG | 100UG |
| Biotinylated Anti-Human PTHrP | 500-P276Bt-50UG | 50UG |
| Biotinylated Anti-Rat VEGF 165 | 500-P275Bt-25UG | 25UG |
| Biotinylated Anti-Rat EGF | 500-P277Bt-50UG | 50UG |
| Anti-Human sDLL-4 | 500-P279-100UG | 100UG |
| Biotinylated Anti-Human sDLL-4 | 500-P279Bt-50UG | 50UG |
| Biotinylated Anti-Human TIMP-1 | 500-P280Bt-1MG | 1MG |
| Biotinylated Anti-Human p16-INK4a-TAT | 500-P284TBt-1MG | 1MG |
| Anti-Human ICAM-1 | 500-P287-1MG | 1MG |
| Biotinylated Anti-Rat IP-10 (CXCL10) | 500-P290Bt-25UG | 25UG |
| Anti-Human MEC (CCL28) | 500-P297-1MG | 1MG |
| Biotinylated Anti-Human sTRAIL Receptor-2 | 500-P299Bt-25UG | 25UG |
| Anti-Murine TRAIL | 500-P303-100UG | 100UG |
| Biotinylated Anti-Murine TRAIL | 500-P303Bt-50UG | 50UG |
| Anti-Murine LIGHT | 500-P308-100UG | 100UG |
| Biotinylated Anti-Murine LIGHT | 500-P308BT-50UG | 50UG |
| Anti-Human PD-L1 Fc | 500-P321-100UG | 100UG |
| Biotinylated Anti-Human sCD14 | 500-P320Bt-50UG | 50UG |
| Biotinylated Anti-Human Amphiregulin | 500-P322Bt-50UG | 50UG |
| Anti-Human sIL-4 Receptor alpha | 500-P325-100UG | 100UG |
| Anti-Human VAP-1 | 500-P326-100UG | 100UG |
| Anti-Human sCD34 | 500-P327-50UG | 50UG |
| Anti-Human ApoA-I | 500-P331-100UG | 100UG |
| Anti-Human Uteroglobin | 500-P330-100UG | 100UG |
| Murine IL-3 Standard ABTS ELISA Development Kit | 900-K48 | 1kit |
| Human beta-NGF Standard ABTS ELISA Development Kit | 900-K60 | 1kit |
| Murine SCF Standard ABTS ELISA Development Kit | 900-K78 | 1kit |
| Human IL-12 Standard ABTS ELISA Development Kit | 900-K96 | 1kit |
| Human IL-1beta Standard ABTS ELISA Development Kit | 900-K95 | 1kit |
| Murine IL-2 Standard ABTS ELISA Development Kit | 900-K108 | 1kit |
| Human IL-17F Standard ABTS ELISA Development Kit | 900-K277 | 1kit |
| Human CTGF Standard ABTS ELISA Development Kit | 900-K317 | 1kit |
| Human FGF-basic Mini ABTS ELISA Development Kit | 900-M08 | 1kit |
| Human IL-8 (CXCL8) Mini ABTS ELISA Development Kit | 900-M18 | 1kit |
| Human GM-CSF Mini ABTS ELISA Development Kit | 900-M30 | 1kit |
| Murine IL-6 Mini ABTS ELISA Development Kit | 900-M50 | 1kit |
| Human beta-NGF Mini ABTS ELISA Development Kit | 900-M60 | 1kit |
| Murine KC (CXCL1) Mini ABTS ELISA Development Kit | 900-M127 | 1kit |
| Murine M-CSF Mini ABTS ELISA Development Kit | 900-M245 | 1kit |
| Biotinylated Anti-Human TSLP | 500-P258Bt-25UG | 25UG |
| Anti-Human Endostatin | 500-P262-50UG | 50UG |
| Anti-Murine IL-17A | 500-P265-50UG | 50UG |
| Anti-Human VEGF-B | 500-P267-100UG | 100UG |
| Anti-Human Neuroserpin | 500-P271-100UG | 100UG |
| Anti-Rat EGF | 500-P277-50UG | 50UG |
| Biotinylated Anti-Murine IL-21 | 500-P278Bt-25UG | 25UG |
| Biotinylated Anti-Human TIMP-1 | 500-P280Bt-50UG | 50UG |
| Anti-Human p16-INK4a-TAT | 500-P284T-100UG | 100UG |
| Biotinylated Anti-Human ICAM-1 | 500-P287Bt-50UG | 50UG |
| Anti-Human sFas Receptor | 500-P295-1MG | 1MG |
| Biotinylated Anti-Human MEC (CCL28) | 500-P297Bt-50UG | 50UG |
| Anti-Human sTRAIL Receptor-2 | 500-P299-50UG | 50UG |
| Anti-Human PD-L1 Fc | 500-P321-1MG | 1MG |
| Biotinylated Anti-Human PD-L1 Fc | 500-P321Bt-50UG | 50UG |
| Biotinylated Anti-Human BD-5 | 500-P323Bt-1MG | 1MG |
| Biotinylated Anti-Human BD-5 | 500-P323Bt-25UG | 25UG |
| Anti-Human sIL-4 Receptor alpha | 500-P325-1MG | 1MG |
| Biotinylated Anti-Human Uteroglobin | 500-P330BT-1MG | 1MG |
| Human IL-10 Standard ABTS ELISA Development Kit | 900-K21 | 1kit |
| Human IP-10 (CXCL10) Standard ABTS ELISA Development Kit | 900-K39 | 1kit |
| Murine TNF-alpha Standard ABTS ELISA Development Kit | 900-K54 | 1kit |
| Rat IL-1alpha Standard ABTS ELISA Development Kit | 900-K204 | 1kit |
| Murine M-CSF Standard ABTS ELISA Development Kit | 900-K245 | 1kit |
| Human IGF-BP1 Standard ABTS ELISA Development Kit | 900-K315 | 1kit |
| Rat IP-10 (CXCL10) Standard ABTS ELISA Development Kit | 900-K449 | 1kit |
| Human IL-1alpha Mini ABTS ELISA Development Kit | 900-M11 | 1kit |
| Human GRO-alpha/MGSA (CXCL1) Mini ABTS ELISA Development Kit | 900-M38 | 1kit |
| Human MCP-1 (CCL2) Mini ABTS ELISA Development Kit | 900-M31 | 1kit |
| Rat MCP-1 (CCL2) Mini ABTS ELISA Development Kit | 900-M59 | 1kit |
| Rat RANTES (CCL5) Mini ABTS ELISA Development Kit | 900-M72 | 1kit |
| Murine IL-1alpha Mini ABTS ELISA Development Kit | 900-M82 | 1kit |
| Rat IL-1beta Mini ABTS ELISA Development Kit | 900-M91 | 1kit |
| Human sTRAIL/Apo2L Mini ABTS ELISA Development Kit | 900-M141 | 1kit |
| Murine JE/MCP-1 (CCL2) Mini ABTS ELISA Development Kit | 900-M126 | 1kit |
| Biotinylated Anti-Human Vaspin | 500-P256Bt-25UG | 25UG |
| Biotinylated Anti-Human TSLP | 500-P258Bt-1MG | 1MG |
| Anti-Human PAI-1 | 500-P260-1MG | 1MG |
| Anti-Rat EGF | 500-P277-100UG | 100UG |
| Biotinylated Anti-Rat EGF | 500-P277Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-21 | 500-P278Bt-1MG | 1MG |
| Anti-Human p16-INK4a-TAT | 500-P284T-50UG | 50UG |
| Biotinylated Anti-Human ICAM-1 | 500-P287Bt-1MG | 1MG |
| Biotinylated Anti-Human ICAM-1 | 500-P287Bt-25UG | 25UG |
| Anti-Rat IP-10 (CXCL10) | 500-P290-50UG | 50UG |
| Biotinylated Anti-Human Heregulinbeta-1 | 500-P288Bt-1MG | 1MG |
| Biotinylated Anti-Human MEC (CCL28) | 500-P297Bt-25UG | 25UG |
| Biotinylated Anti-Human MEC (CCL28) | 500-P297Bt-1MG | 1MG |
| Anti-Human EGF Receptor (EGFR) | 500-P306-1MG | 1MG |
| Biotinylated Anti-Murine TRAIL | 500-P303Bt-1MG | 1MG |
| Biotinylated Anti-Rat IL-7 | 500-P310Bt-25UG | 25UG |
| Biotinylated Anti-Rat SDF-1alpha (CXCL12) | 500-P315Bt-25UG | 25UG |
| Biotinylated Anti-Human sCD14 | 500-P320Bt-25UG | 25UG |
| Biotinylated Anti-Human PD-L1 Fc | 500-P321Bt-25UG | 25UG |
| Anti-Human Amphiregulin | 500-P322-100UG | 100UG |
| Anti-Human MMP-3 | 500-P324-50UG | 50UG |
| Biotinylated Anti-Human sIL-4 Receptor alpha | 500-P325BT-50UG | 50UG |
| Biotinylated Anti-Human ApoA-I | 500-P331BT-50UG | 50UG |
| Human IL-3 Standard ABTS ELISA Development Kit | 900-K13 | 1kit |
| Murine Eotaxin (CCL11) Standard ABTS ELISA Development Kit | 900-K68 | 1kit |
| Murine IFN-gamma Standard ABTS ELISA Development Kit | 900-K98 | 1kit |
| Human IL-20 Standard ABTS ELISA Development Kit | 900-K224 | 1kit |
| Rat SCF Standard ABTS ELISA Development Kit | 900-K258 | 1kit |
| Human TL-1A Standard ABTS ELISA Development Kit | 900-K290 | 1kit |
| Murine MIP-1beta (CCL4) Standard ABTS ELISA Development Kit | 900-K278 | 1kit |
| Human IL-31 Standard ABTS ELISA Development Kit | 900-K347 | 1kit |
| Human IL-6 Mini ABTS ELISA Development Kit | 900-M16 | 1kit |
| Human IL-13 Mini ABTS ELISA Development Kit | 900-M23 | 1kit |
| Murine TNF-alpha Mini ABTS ELISA Development Kit | 900-M54 | 1kit |
| Rat CNTF Mini ABTS ELISA Development Kit | 900-M65 | 1kit |
| Human GRO-beta (CXCL2) Mini ABTS ELISA Development Kit | 900-M120 | 1kit |
| Human BD-1 Mini ABTS ELISA Development Kit | 900-M202 | 1kit |
| Murine sRANK Ligand Mini ABTS ELISA Development Kit | 900-M233 | 1kit |
| Human Heregulinbeta-1 Mini ABTS ELISA Development Kit | 900-M316 | 1kit |
| Human IL-33 Mini ABTS ELISA Development Kit | 900-M398 | 1kit |
| Human IL-2 Standard TMB ELISA Development Kit | 900-T12 | 1kit |
| Rat TNF-alpha Standard TMB ELISA Development Kit | 900-T73 | 1kit |
| Murine TNF-alpha Standard TMB ELISA Development Kit | 900-T54 | 1kit |
| Murine IL-12 Standard TMB ELISA Development Kit | 900-T97 | 1kit |
| Human IP-10 (CXCL10) Mini TMB ELISA Development Kit | 900-TM39 | 1kit |
| Murine IFN-gamma Mini TMB ELISA Development Kit | 900-TM98 | 1kit |
| PeproGrow hESC (Embryonic Stem Cell) Growth Factor Component | GF-HESC-100 | 100mL |
| Human CTGF Mini ABTS ELISA Development Kit | 900-M317 | 1kit |
| Human TL-1A Mini ABTS ELISA Development Kit | 900-M290 | 1kit |
| Human IL-6 Standard TMB ELISA Development Kit | 900-T16 | 1kit |
| Human MCP-1 (CCL2) Standard TMB ELISA Development Kit | 900-T31 | 1kit |
| Murine IFN-gamma Standard TMB ELISA Development Kit | 900-T98 | 1kit |
| Murine IL-10 Standard TMB ELISA Development Kit | 900-T53 | 1kit |
| Human IL-8 (CXCL8) Mini TMB ELISA Development Kit | 900-TM18 | 1kit |
| Human IL-1alpha Mini TMB ELISA Development Kit | 900-TM11 | 1kit |
| Murine IL-6 Mini TMB ELISA Development Kit | 900-TM50 | 1kit |
| Human IL-31 Mini ABTS ELISA Development Kit | 900-M347 | 1kit |
| Rat SCF Mini ABTS ELISA Development Kit | 900-M258 | 1kit |
| Rat VEGF 165 Mini ABTS ELISA Development Kit | 900-M436 | 1kit |
| Human SCF Standard TMB ELISA Development Kit | 900-T34 | 1kit |
| Human/Murine/Rat BMP-2 Standard TMB ELISA Development Kit | 900-T255 | 1kit |
| Human IL-6 Mini TMB ELISA Development Kit | 900-TM16 | 1kit |
| Human IL-1beta Mini TMB ELISA Development Kit | 900-TM95 | 1kit |
| Human MCP-1 (CCL2) Mini TMB ELISA Development Kit | 900-TM31 | 1kit |
| Cell Passaging/Non-Enzymatic Detachment Buffer | CPD-125 | 125mL |
| Murine IL-21 Mini ABTS ELISA Development Kit | 900-M368 | 1kit |
| Human BD-2 Standard TMB ELISA Development Kit | 900-T172 | 1kit |
| Human IL-17E Standard TMB ELISA Development Kit | 900-T234 | 1kit |
| Murine IL-4 Mini TMB ELISA Development Kit | 900-TM49 | 1kit |
| Animal-Free Human Hematopoietic Stem Cell Expansion Cytokine Package (IL-6) | AF-HHSC6 | 1Pack |
| Human Hematopoietic Stem Cell Expansion Cytokine Package (IL-6) | HHSC6 | 1Pack |
| Human IL-1alpha | AF-200-01A-2UG | 2UG |
| Rat TNF-alpha | 400-14-5UG | 5UG |
| Murine IL-1beta | 211-11B-10UG | 10UG |
| Human Exodus-2 (CCL21) | 300-35A-20UG | 20UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-10UG | 10UG |
| Human I-TAC (CXCL11) | AF-300-46-5UG | 5UG |
| Human I-TAC (CXCL11) | AF-300-46-250UG | 250UG |
| Human Apo-SAA1 | AF-300-53-50UG | 50UG |
| Human sRANK Ligand (E.coli derived) | AF-310-01-1MG | 1MG |
| Human TWEAK | AF-310-06-250UG | 250UG |
| Human 4-1BB Ligand | AF-310-11-250UG | 250UG |
| Animal-Free Recombinant Human Heregulinbeta-1 | AF-100-03-100UG | 100UG |
| Human IL-1alpha | AF-200-01A-500UG | 500UG |
| Human IL-3 | AF-200-03-250UG | 250UG |
| Recombinant Human Heregulinbeta-1 | 100-03-50UG | 50UG |
| Murine IL-33 | 210-33-10UG | 10UG |
| Human IL-11 | 200-11-50UG | 50UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-100UG | 100UG |
| Murine G-CSF | 250-05-50UG | 50UG |
| Human IL-12 p70 (CHO derived) | 200-12-500UG | 500UG |
| Murine IL-6 | 216-16-2UG | 2UG |
| Human G-CSF | AF-300-23-500UG | 500UG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-100UG | 100UG |
| Human IL-4 | AF-200-04-50UG | 50UG |
| Human IL-5 | AF-200-05-1MG | 1MG |
| Human IL-6 | AF-200-06-250UG | 250UG |
| Human IL-11 | AF-200-11-10UG | 10UG |
| Human IL-11 | AF-200-11-100UG | 100UG |
| Human IL-17A | AF-200-17-500UG | 500UG |
| Human IL-21 | AF-200-21-50UG | 50UG |
| Human IL-22 | AF-200-22-2UG | 2UG |
| Human IL-17E | AF-200-24-500UG | 500UG |
| Human IL-17D | AF-200-27-250UG | 250UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-250UG | 250UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-100UG | 100UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-1MG | 1MG |
| Human IL-37 (IL-1F7) | AF-200-39-500UG | 500UG |
| Murine IL-21 | AF-210-21-100UG | 100UG |
| Murine IL-22 | AF-210-22-250UG | 250UG |
| Murine IL-1beta | AF-211-11B-50UG | 50UG |
| Murine IL-3 | AF-213-13-2UG | 2UG |
| Murine IL-3 | AF-213-13-500UG | 500UG |
| Murine IL-6 | AF-216-16-500UG | 500UG |
| Murine SCF | AF-250-03-500UG | 500UG |
| Human IFN-beta | AF-300-02B-250UG | 250UG |
| Human IFN-beta | AF-300-02B-100UG | 100UG |
| Human IFN-lambda1 | AF-300-02L-20UG | 20UG |
| Human GM-CSF | AF-300-03-1MG | 1MG |
| Human SCF | AF-300-07-500UG | 500UG |
| Human MIP-1alpha (CCL3) | AF-300-08-1MG | 1MG |
| Animal-Free Recombinant Human Oncostatin M (209 a.a.) | AF-300-10T-250UG | 250UG |
| Human MCP-2 (CCL8) | AF-300-15-100UG | 100UG |
| Human M-CSF | AF-300-25-10UG | 10UG |
| Human M-CSF | AF-300-25-500UG | 500UG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-250UG | 250UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-2UG | 2UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-250UG | 250UG |
| Human Apo-SAA1 | AF-300-53-500UG | 500UG |
| Human BD-5 | AF-300-68-100UG | 100UG |
| Human BD-5 | AF-300-68-1MG | 1MG |
| Human sCD40 Ligand | AF-310-02-250UG | 250UG |
| Human sTNF Receptor Type I | AF-310-07-5UG | 5UG |
| Human TL-1A | AF-310-23-5UG | 5UG |
| Human Epiregulin | AF-100-04-250UG | 250UG |
| Human Epiregulin | AF-100-04-5UG | 5UG |
| Human Epiregulin | AF-100-04-100UG | 100UG |
| Human Vitronectin | AF-140-09-1MG | 1MG |
| Human IL-4 | AF-200-04-5UG | 5UG |
| Human IL-5 | AF-200-05-10UG | 10UG |
| Human IL-7 | AF-200-07-1MG | 1MG |
| Human IL-9 | AF-200-09-50UG | 50UG |
| Human IL-10 | AF-200-10-100UG | 100UG |
| Human IL-11 | AF-200-11-500UG | 500UG |
| Human IL-11 | AF-200-11-50UG | 50UG |
| Human IL-13 | AF-200-13-250UG | 250UG |
| Human IL-21 | AF-200-21-2UG | 2UG |
| Human IL-36gamma (IL-1F9) | AF-200-36G-10UG | 10UG |
| Human IL-37 (IL-1F7) | AF-200-39-1MG | 1MG |
| Murine IL-10 | AF-210-10-100UG | 100UG |
| Murine IL-21 | AF-210-21-500UG | 500UG |
| Murine IL-22 | AF-210-22-50UG | 50UG |
| Murine IL-1beta | AF-211-11B-1MG | 1MG |
| Murine IL-2 | AF-212-12-250UG | 250UG |
| Murine IL-3 | AF-213-13-50UG | 50UG |
| Murine IL-3 | AF-213-13-1MG | 1MG |
| Murine IL-4 | AF-214-14-250UG | 250UG |
| Murine BD-3 | AF-250-41-50UG | 50UG |
| Murine BD-3 | AF-250-41-100UG | 100UG |
| Human TNF-alpha | AF-300-01A-250UG | 250UG |
| Human IFN-beta | AF-300-02B-20UG | 20UG |
| Human IFN-beta | AF-300-02B-1MG | 1MG |
| Human GM-CSF | AF-300-03-250UG | 250UG |
| Human IFN-lambda1 | AF-300-02L-500UG | 500UG |
| Human MCP-1 (CCL2) | AF-300-04-1MG | 1MG |
| Human SCF | AF-300-07-100UG | 100UG |
| Human MIP-1alpha (CCL3) | AF-300-08-5UG | 5UG |
| Human MIP-1alpha (CCL3) | AF-300-08-500UG | 500UG |
| Animal-Free Recombinant Human Oncostatin M (209 a.a.) | AF-300-10T-1MG | 1MG |
| Human M-CSF | AF-300-25-100UG | 100UG |
| Human SDF-1alpha (CXCL12) | AF-300-28A-10UG | 10UG |
| Human SDF-1beta (CXCL12) | AF-300-28B-50UG | 50UG |
| Human TECK (CCL25) | AF-300-45-100UG | 100UG |
| Human sRANK Ligand (E.coli derived) | AF-310-01-100UG | 100UG |
| Human TWEAK | AF-310-06-1MG | 1MG |
| Murine IL-2 | AF-212-12-5UG | 5UG |
| Murine IL-2 | AF-212-12-500UG | 500UG |
| Murine IL-2 | AF-212-12-1MG | 1MG |
| Murine IL-3 | AF-213-13-250UG | 250UG |
| Murine IL-4 | AF-214-14-50UG | 50UG |
| Murine SCF | AF-250-03-10UG | 10UG |
| Murine G-CSF | AF-250-05-500UG | 500UG |
| Murine BD-3 | AF-250-41-250UG | 250UG |
| Human TNF-alpha | AF-300-01A-1MG | 1MG |
| Human IFN-lambda1 | AF-300-02L-5UG | 5UG |
| Human GM-CSF | AF-300-03-500UG | 500UG |
| Human GRO-alpha/MGSA (CXCL1) | AF-300-11-5UG | 5UG |
| Human M-CSF | AF-300-25-250UG | 250UG |
| Human M-CSF | AF-300-25-1MG | 1MG |
| Human SDF-1beta (CXCL12) | AF-300-28B-100UG | 100UG |
| Human BD-5 | AF-300-68-20UG | 20UG |
| Human sRANK Ligand (E.coli derived) | AF-310-01-250UG | 250UG |
| Human 4-1BB Ligand | AF-310-11-500UG | 500UG |
| Murine M-CSF | AF-315-02-100UG | 100UG |
| Human TL-1A | AF-310-23-250UG | 250UG |
| Murine TNF-alpha | AF-315-01A-20UG | 20UG |
| Murine TNF-alpha | AF-315-01A-100UG | 100UG |
| Murine LIGHT | AF-315-12-1MG | 1MG |
| Murine TPO | AF-315-14-50UG | 50UG |
| Rat SCF | AF-400-22-2UG | 2UG |
| Rat SCF | AF-400-22-250UG | 250UG |
| Human NT-4 | AF-450-04-100UG | 100UG |
| Anti-Human MIP-3beta (CCL19) (Monoclonal Mouse) | 500-M29-500UG | 500UG |
| Anti-Human FGF-5 (Monoclonal Mouse) | 500-M40-500UG | 500UG |
| Anti-Human TECK (CCL25) (Monoclonal Mouse) | 500-M48-500UG | 500UG |
| Anti-Human MIP-1alpha (CCL3) (Monoclonal Mouse) | 500-M74-500UG | 500UG |
| Biotinylated Anti-Human IL-11 | 500-P01Bt-1MG | 1MG |
| Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03G-50UG | 50UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Goat) | 500-P04G-50UG | 50UG |
| Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10G-1MG | 1MG |
| Anti-Human IGF-I | 500-P11-50UG | 50UG |
| Anti-Human IGF-II | 500-P12-100UG | 100UG |
| Anti-Human TGF-alpha | 500-P16-50UG | 50UG |
| Anti-Human KGF (FGF-7) | 500-P19-50UG | 50UG |
| Biotinylated Anti-Human KGF (FGF-7) | 500-P19Bt-50UG | 50UG |
| Anti-Human IL-10 | 500-P20-1MG | 1MG |
| Anti-Human IL-3 | 500-P23-50UG | 50UG |
| Biotinylated Anti-Human IL-5 | 500-P25Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-6 (Polyclonal Rabbit) | 500-P26Bt-50UG | 50UG |
| Anti-Human IL-7 | 500-P27-1MG | 1MG |
| Biotinylated Anti-Human IL-6 (Polyclonal Goat) | 500-P26GBt-25UG | 25UG |
| Anti-Human IL-8 (CXCL8) | 500-P28-100UG | 100UG |
| Biotinylated Anti-Human IL-7 | 500-P27Bt-1MG | 1MG |
| Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31A-1MG | 1MG |
| Anti-Human TNF-beta | 500-P31B-50UG | 50UG |
| Anti-Human IFN-beta | 500-P32B-1MG | 1MG |
| Biotinylated Anti-Human IFN-gamma | 500-P32Bt-50UG | 50UG |
| Anti-Human MCP-2 (CCL8) | 500-P35-50UG | 50UG |
| Biotinylated Anti-Human RANTES (CCL5) | 500-P36Bt-25UG | 25UG |
| Anti-Human MIP-1beta (CCL4) | 500-P38B-1MG | 1MG |
| Biotinylated Anti-Human MIP-1beta (CCL4) | 500-P38BBt-1MG | 1MG |
| Biotinylated Anti-Human MIP-1alpha (CCL3) (Polyclonal Rabbit) | 500-P38Bt-50UG | 50UG |
| Anti-Human Flt3-Ligand | 500-P42-50UG | 50UG |
| Biotinylated Anti-Human Flt3-Ligand | 500-P42Bt-50UG | 50UG |
| Anti-Human G-CSF | 500-P43-1MG | 1MG |
| Anti-Human EGF | 500-P45-1MG | 1MG |
| Anti-Human PDGF-BB | 500-P47-50UG | 50UG |
| Biotinylated Anti-Human TPO (Polyclonal Goat) | 500-P49GBt-50UG | 50UG |
| Murine GM-CSF | AF-315-03-5UG | 5UG |
| Murine GM-CSF | AF-315-03-50UG | 50UG |
| Murine TPO | AF-315-14-10UG | 10UG |
| Rat SCF | AF-400-22-100UG | 100UG |
| Rat GM-CSF | AF-400-23-50UG | 50UG |
| Rat M-CSF | AF-400-28-2UG | 2UG |
| Rat TPO | AF-400-34-100UG | 100UG |
| Rat M-CSF | AF-400-28-10UG | 10UG |
| Rat TPO | AF-400-34-2UG | 2UG |
| Human GDNF | AF-450-10-10UG | 10UG |
| Human Artemin | AF-450-17-1MG | 1MG |
| Human Enterokinase | AF-450-48C-50UG | 50UG |
| Anti-Human IL-4 (Monoclonal Mouse) | 500-M04-500UG | 500UG |
| Anti-Human MDC (CCL22) (Monoclonal Mouse) | 500-M41-500UG | 500UG |
| Anti-Human CRP (Monoclonal Mouse) | 500-M50-500UG | 500UG |
| Anti-Human LEC (CCL16) (Monoclonal Mouse) | 500-M43-500UG | 500UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03Bt-50UG | 50UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03Bt-25UG | 25UG |
| Anti-Human MCP-4 (CCL13) (Polyclonal Rabbit) | 500-P04-100UG | 100UG |
| Anti-Human PF-4 (CXCL4) | 500-P05-100UG | 100UG |
| Biotinylated Anti-Human PF-4 (CXCL4) | 500-P05Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-16 | 500-P06Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07Bt-1MG | 1MG |
| Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10-100UG | 100UG |
| Anti-Human IL-13 | 500-P13-50UG | 50UG |
| Anti-Human IL-15 | 500-P15-100UG | 100UG |
| Anti-Human FGF-basic | 500-P18-1MG | 1MG |
| Biotinylated Anti-Human IL-1beta | 500-P21BGBt-1MG | 1MG |
| Biotinylated Anti-Human IL-1beta | 500-P21BGBt-25UG | 25UG |
| Anti-Human IL-3 | 500-P23-100UG | 100UG |
| Anti-Human IL-5 | 500-P25-100UG | 100UG |
| Biotinylated Anti-Human IL-4 | 500-P24Bt-25UG | 25UG |
| Anti-Human IL-4 | 500-P24-100UG | 100UG |
| Anti-Human IL-9 | 500-P29-50UG | 50UG |
| Anti-Human IL-8 (CXCL8) | 500-P28-50UG | 50UG |
| Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31A-100UG | 100UG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31ABt-50UG | 50UG |
| Biotinylated Anti-Human IFN-gamma | 500-P32Bt-25UG | 25UG |
| Biotinylated Anti-Human GM-CSF | 500-P33Bt-50UG | 50UG |
| Biotinylated Anti-Human MIP-1beta (CCL4) | 500-P38BBt-50UG | 50UG |
| Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41-50UG | 50UG |
| Biotinylated Anti-Human SCF (Polyclonal Goat) | 500-P48GBt-25UG | 25UG |
| Murine M-CSF | AF-315-02-500UG | 500UG |
| Murine LIGHT | AF-315-12-20UG | 20UG |
| Rat IL-2 | AF-400-02-5UG | 5UG |
| Rat SCF | AF-400-22-500UG | 500UG |
| Rat TPO | AF-400-34-250UG | 250UG |
| Human NT-4 | AF-450-04-250UG | 250UG |
| Human Artemin | AF-450-17-20UG | 20UG |
| Human Enterokinase | AF-450-48C-100UG | 100UG |
| Anti-Human Leptin (Monoclonal Mouse) | 500-M27-500UG | 500UG |
| Anti-Human NAP-2 (CXCL7) (Monoclonal Mouse) | 500-M33-500UG | 500UG |
| Anti-Human MCP-2 (CCL8) (Monoclonal Mouse) | 500-M69-500UG | 500UG |
| Anti-Murine IL-10 (Monoclonal Rat) | 500-M128-500UG | 500UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Goat) | 500-P03GBt-50UG | 50UG |
| Biotinylated Anti-Human PF-4 (CXCL4) | 500-P05Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-17A (Polyclonal Rabbit) | 500-P07Bt-25UG | 25UG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Rabbit) | 500-P10Bt-25UG | 25UG |
| Anti-Human TGF-alpha | 500-P16-1MG | 1MG |
| Anti-Human FGF-basic | 500-P18-100UG | 100UG |
| Anti-Human KGF (FGF-7) | 500-P19-100UG | 100UG |
| Biotinylated Anti-Human IL-10 | 500-P20Bt-25UG | 25UG |
| Anti-Human IL-1alpha | 500-P21A-100UG | 100UG |
| Anti-Human sIL-2 Receptor alpha | 500-P22R-100UG | 100UG |
| Anti-Human IL-3 | 500-P23-1MG | 1MG |
| Biotinylated Anti-Human sIL-2 Receptor alpha | 500-P22RBt-1MG | 1MG |
| Biotinylated Anti-Human IL-4 | 500-P24Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-5 | 500-P25Bt-25UG | 25UG |
| Biotinylated Anti-Human IL-7 | 500-P27Bt-25UG | 25UG |
| Anti-Human IL-8 (CXCL8) | 500-P28-1MG | 1MG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Goat) | 500-P31AGBt-50UG | 50UG |
| Biotinylated Anti-Human IFN-beta | 500-P32BBt-25UG | 25UG |
| Biotinylated Anti-Human MCP-2 (CCL8) | 500-P35Bt-1MG | 1MG |
| Biotinylated Anti-Human RANTES (CCL5) | 500-P36Bt-1MG | 1MG |
| Anti-Human LIF | 500-P39-1MG | 1MG |
| Biotinylated Anti-Human Eotaxin (CCL11) (Polyclonal Rabbit) | 500-P41Bt-25UG | 25UG |
| Anti-Human Flt3-Ligand | 500-P42-100UG | 100UG |
| Biotinylated Anti-Human Flt3-Ligand | 500-P42Bt-1MG | 1MG |
| Anti-Human M-CSF | 500-P44-50UG | 50UG |
| Anti-Human PDGF-AA | 500-P46-100UG | 100UG |
| Biotinylated Anti-Human PDGF-AA | 500-P46Bt-50UG | 50UG |
| Biotinylated Anti-Human SCF (Polyclonal Goat) | 500-P48GBt-50UG | 50UG |
| Biotinylated Anti-Human TPO (Polyclonal Rabbit) | 500-P49Bt-50UG | 50UG |
| Murine IFN-gamma | AF-315-05-1MG | 1MG |
| Rat IL-2 | AF-400-02-1MG | 1MG |
| Rat TPO | AF-400-34-500UG | 500UG |
| Human Enterokinase | AF-450-48C-500UG | 500UG |
| Anti-Human IL-3 (Monoclonal Mouse) | 500-M03-500UG | 500UG |
| Anti-Human Eotaxin-3 (CCL26) (Monoclonal Mouse) | 500-M32-500UG | 500UG |
| Anti-Human TGF-beta1 (Monoclonal Mouse) | 500-M66-500UG | 500UG |
| Anti-Human MCP-4 (CCL13) (Monoclonal Mouse) | 500-M70-500UG | 500UG |
| Anti-Human IL-10 (Monoclonal Mouse) | 500-M86-500UG | 500UG |
| Anti-Human BMP-4 (Monoclonal Mouse) | 500-M121-500UG | 500UG |
| Biotinylated Anti-Human NAP-2 (CXCL7) (Polyclonal Rabbit) | 500-P03Bt-1MG | 1MG |
| Biotinylated Anti-Human VEGF 165 (Polyclonal Goat) | 500-P10GBt-50UG | 50UG |
| Biotinylated Anti-Human IGF-II | 500-P12Bt-25UG | 25UG |
| Biotinylated Anti-Human TGF-alpha | 500-P16Bt-1MG | 1MG |
| Anti-Human IL-10 | 500-P20-50UG | 50UG |
| Biotinylated Anti-Human IL-10 | 500-P20Bt-50UG | 50UG |
| Anti-Human IL-1alpha | 500-P21A-1MG | 1MG |
| Anti-Human IL-2 (Polyclonal Rabbit) | 500-P22-100UG | 100UG |
| Anti-Human IL-6 (Polyclonal Rabbit) | 500-P26-1MG | 1MG |
| Anti-Human IL-6 (Polyclonal Goat) | 500-P26G-50UG | 50UG |
| Biotinylated Anti-Human IL-7 | 500-P27Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-8 (CXCL8) | 500-P28Bt-1MG | 1MG |
| Anti-Human IL-9 | 500-P29-1MG | 1MG |
| Biotinylated Anti-Human TNF-alpha (Polyclonal Rabbit) | 500-P31ABt-1MG | 1MG |
| Biotinylated Anti-Human IFN-beta | 500-P32BBt-1MG | 1MG |
| Biotinylated Anti-Human MCP-2 (CCL8) | 500-P35Bt-25UG | 25UG |
| Anti-Human MCP-3 (CCL7) | 500-P37G-50UG | 50UG |
| Biotinylated Anti-Human G-CSF | 500-P43Bt-50UG | 50UG |
| Biotinylated Anti-Human M-CSF | 500-P44Bt-25UG | 25UG |
| Anti-Human EGF | 500-P45-50UG | 50UG |
| Anti-Human PDGF-AA | 500-P46-1MG | 1MG |
| Anti-Human SCF (Polyclonal Goat) | 500-P48G-1MG | 1MG |
| Anti-Human TPO (Polyclonal Rabbit) | 500-P49-100UG | 100UG |
| Anti-Human TPO (Polyclonal Goat) | 500-P49G-1MG | 1MG |
| Biotinylated Anti-Murine IL-1alpha | 500-P51ABt-1MG | 1MG |
| Biotinylated Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92Bt-25UG | 25UG |
| Anti-Human IP-10 (CXCL10) | 500-P93-1MG | 1MG |
| Anti-Human MIP-3alpha (CCL20) | 500-P95A-1MG | 1MG |
| Biotinylated Anti-Human TARC (CCL17) | 500-P97Bt-1MG | 1MG |
| Biotinylated Anti-Human Cardiotrophin-1 | 500-P101Bt-50UG | 50UG |
| Biotinylated Anti-Human Eotaxin-2 (CCL24) | 500-P103GBt-25UG | 25UG |
| Biotinylated Anti-Human HCC-1 (CCL14) | 500-P106Bt-50UG | 50UG |
| Anti-Human MIP-4 (CCL18) | 500-P108-1MG | 1MG |
| Anti-Murine C10 (CCL6) | 500-P112-1MG | 1MG |
| Biotinylated Anti-Murine IL-2 | 500-P111Bt-1MG | 1MG |
| Anti-Murine MIP-1gamma (CCL9/10) | 500-P117-1MG | 1MG |
| Anti-Murine IFN-gamma | 500-P119-100UG | 100UG |
| Anti-Human GCP-2 (CXCL6) | 500-P120-1MG | 1MG |
| Biotinylated Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122GBt-25UG | 25UG |
| Anti-Human MIP-5 (CCL15) | 500-P123G-50UG | 50UG |
| Biotinylated Anti-Human MIP-5 (CCL15) | 500-P123GBt-25UG | 25UG |
| Anti-Human MIP-3 (CCL23) | 500-P124-100UG | 100UG |
| Anti-Human LEC (CCL16) | 500-P125G-1MG | 1MG |
| Biotinylated Anti-Human NP-1 | 500-P126GBt-50UG | 50UG |
| Anti-Murine IP-10 (CXCL10) | 500-P129-100UG | 100UG |
| Anti-Human sRANK Ligand (Polyclonal Rabbit) | 500-P133-50UG | 50UG |
| Biotinylated Anti-Human sRANK Ligand (Polyclonal Goat) | 500-P133GBt-50UG | 50UG |
| Biotinylated Anti-Human Persephin | 500-P138Bt-50UG | 50UG |
| Anti-Human CNTF | 500-P140-1MG | 1MG |
| Anti-Human sTNF Receptor Type I | 500-P143-100UG | 100UG |
| Anti-Human sRANK Receptor | 500-P144-1MG | 1MG |
| Anti-Murine LIX (CXCL6) | 500-P146-1MG | 1MG |
| Biotinylated Anti-Human TPO (Polyclonal Rabbit) | 500-P49Bt-1MG | 1MG |
| Biotinylated Anti-Human MIG (CXCL9) | 500-P50Bt-1MG | 1MG |
| Anti-Murine IL-1alpha | 500-P51A-50UG | 50UG |
| Anti-Murine IL-3 | 500-P53-50UG | 50UG |
| Biotinylated Anti-Murine IL-6 | 500-P56Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-9 | 500-P59Bt-50UG | 50UG |
| Biotinylated Anti-Murine IL-10 | 500-P60Bt-50UG | 50UG |
| Biotinylated Anti-Murine TNF-alpha (Polyclonal Rabbit) | 500-P64Bt-50UG | 50UG |
| Anti-Rat TNF-alpha | 500-P72-100UG | 100UG |
| Anti-Rat IL-6 (Polyclonal Rabbit) | 500-P73-100UG | 100UG |
| Anti-Rat IL-6 (Polyclonal Goat) | 500-P73G-100UG | 100UG |
| Biotinylated Anti-Rat IL-6 (Polyclonal Goat) | 500-P73GBt-50UG | 50UG |
| Biotinylated Anti-Rat GRO-beta/MIP-2 (CXCL2) | 500-P75Bt-50UG | 50UG |
| Biotinylated Anti-Rat MIP-1alpha (CCL3) | 500-P77Bt-25UG | 25UG |
| Anti-Rat CNTF | 500-P79-50UG | 50UG |
| Biotinylated Anti-Rat CNTF | 500-P79Bt-25UG | 25UG |
| Biotinylated Anti-Human NT-3 (Polyclonal Rabbit) | 500-P82Bt-50UG | 50UG |
| Biotinylated Anti-Human GDNF | 500-P81Bt-25UG | 25UG |
| Anti-Human NT-3 (Polyclonal Goat) | 500-P82G-1MG | 1MG |
| Biotinylated Anti-Human NT-4 | 500-P83GBt-25UG | 25UG |
| Biotinylated Anti-Human/Murine/Rat BDNF | 500-P84Bt-25UG | 25UG |
| Anti-Human SDF-1alpha (CXCL12) | 500-P87A-100UG | 100UG |
| Anti-Human SDF-1beta (CXCL12) | 500-P87BG-100UG | 100UG |
| Anti-Human IL-17F | 500-P90-100UG | 100UG |
| Biotinylated Anti-Human ENA-78 (CXCL5) | 500-P91Bt-25UG | 25UG |
| Biotinylated Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92Bt-1MG | 1MG |
| Anti-Human MIP-3beta (CCL19) | 500-P95B-100UG | 100UG |
| Anti-Human MIP-3beta (CCL19) | 500-P95B-50UG | 50UG |
| Biotinylated Anti-Human Fractalkine (CX3CL1) | 500-P98Bt-1MG | 1MG |
| Biotinylated Anti-Human SCGF-beta | 500-P99GBt-25UG | 25UG |
| Anti-Human Neurturin | 500-P102-50UG | 50UG |
| Biotinylated Anti-Human Eotaxin-2 (CCL24) | 500-P103GBt-1MG | 1MG |
| Biotinylated Anti-Human GRO-beta (CXCL2) | 500-P104Bt-50UG | 50UG |
| Biotinylated Anti-Human GRO-gamma (CXCL3) | 500-P105Bt-1MG | 1MG |
| Anti-Human Exodus-2 (CCL21) | 500-P109-50UG | 50UG |
| Anti-Murine C10 (CCL6) | 500-P112-100UG | 100UG |
| Biotinylated Anti-Murine C10 (CCL6) | 500-P112Bt-50UG | 50UG |
| Anti-Murine Exodus-2 (CCL21) | 500-P114-50UG | 50UG |
| Biotinylated Anti-Murine KC (CXCL1) | 500-P115Bt-1MG | 1MG |
| Biotinylated Anti-Murine Exodus-2 (CCL21) | 500-P114Bt-50UG | 50UG |
| Biotinylated Anti-Murine MCP-3 (CCL7) | 500-P116GBt-25UG | 25UG |
| Anti-Murine MIP-1gamma (CCL9/10) | 500-P117-100UG | 100UG |
| Biotinylated Anti-Murine MIP-1alpha (CCL3) | 500-P121Bt-25UG | 25UG |
| Biotinylated Anti-Rat IFN-gamma (Polyclonal Rabbit) | 500-P122Bt-1MG | 1MG |
| Biotinylated Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122GBt-1MG | 1MG |
| Anti-Rat IFN-gamma (Polyclonal Goat) | 500-P122G-1MG | 1MG |
| Biotinylated Anti-Human MIP-3 (CCL23) | 500-P124Bt-50UG | 50UG |
| Biotinylated Anti-Murine MCP-2 (CCL8) | 500-P127Bt-1MG | 1MG |
| Biotinylated Anti-Murine IP-10 (CXCL10) | 500-P129Bt-25UG | 25UG |
| Anti-Human sRANK Ligand (Polyclonal Goat) | 500-P133G-50UG | 50UG |
| Anti-Human sRANK Ligand (Polyclonal Goat) | 500-P133G-1MG | 1MG |
| Biotinylated Anti-Human TECK (CCL25) | 500-P134Bt-50UG | 50UG |
| Anti-Human TWEAK | 500-P137G-100UG | 100UG |
| Anti-Human Persephin | 500-P138-100UG | 100UG |
| Biotinylated Anti-Human Persephin | 500-P138Bt-1MG | 1MG |
| Anti-Rat IL-10 | 500-P139-100UG | 100UG |
| Biotinylated Anti-Human CNTF | 500-P140Bt-50UG | 50UG |
| Biotinylated Anti-Rat IL-10 | 500-P139Bt-25UG | 25UG |
| Anti-Human sCD40 Ligand | 500-P142G-50UG | 50UG |
| Biotinylated Anti-Human sTNF Receptor Type I | 500-P143Bt-50UG | 50UG |
| Anti-Human OPG | 500-P149-1MG | 1MG |
| Biotinylated Anti-Human OPG | 500-P149Bt-50UG | 50UG |
| Biotinylated Anti-Human FGF-10 | 500-P151GBt-25UG | 25UG |
| Biotinylated Anti-Human FGF-17 (Polyclonal Rabbit) | 500-P152Bt-25UG | 25UG |
| Anti-Human FGF-17 (Polyclonal Goat) | 500-P152G-50UG | 50UG |
| Anti-Murine IL-1beta | 500-P51-1MG | 1MG |
| Biotinylated Anti-Human MIG (CXCL9) | 500-P50Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-1beta | 500-P51Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-7 | 500-P57Bt-25UG | 25UG |
| Biotinylated Anti-Murine IL-7 | 500-P57Bt-50UG | 50UG |
| Biotinylated Anti-Murine IL-6 | 500-P56Bt-25UG | 25UG |
| Anti-Murine IL-9 | 500-P59-100UG | 100UG |
| Anti-Murine TNF-alpha (Polyclonal Goat) | 500-P64G-50UG | 50UG |
| Biotinylated Anti-Murine FGF-9 | 500-P66Bt-50UG | 50UG |
| Anti-Rat TNF-alpha | 500-P72-50UG | 50UG |
| Anti-Murine SCF | 500-P71-1MG | 1MG |
| Anti-Rat IL-6 (Polyclonal Rabbit) | 500-P73-50UG | 50UG |
| Anti-Rat IL-6 (Polyclonal Goat) | 500-P73G-50UG | 50UG |
| Anti-Human GDNF | 500-P81-1MG | 1MG |
| Anti-Human NT-3 (Polyclonal Rabbit) | 500-P82-1MG | 1MG |
| Biotinylated Anti-Human NT-3 (Polyclonal Goat) | 500-P82GBt-50UG | 50UG |
| Biotinylated Anti-Human Leptin | 500-P86Bt-50UG | 50UG |
| Biotinylated Anti-Human SDF-1alpha (CXCL12) | 500-P87ABt-25UG | 25UG |
| Biotinylated Anti-Human SDF-1beta (CXCL12) | 500-P87BGBt-1MG | 1MG |
| Anti-Human GRO-alpha/MGSA (CXCL1) | 500-P92-1MG | 1MG |
| Anti-Rat IL-4 | 500-P94-50UG | 50UG |
| Biotinylated Anti-Human MIP-3alpha (CCL20) | 500-P95ABt-1MG | 1MG |
| Anti-Human Fractalkine (CX3CL1) | 500-P98-50UG | 50UG |
| Anti-Human Fractalkine (CX3CL1) | 500-P98-1MG | 1MG |
| Anti-Human Cardiotrophin-1 | 500-P101-50UG | 50UG |
| Biotinylated Anti-Human Cardiotrophin-1 | 500-P101Bt-1MG | 1MG |
| Biotinylated Anti-Human Neurturin | 500-P102Bt-25UG | 25UG |
| Biotinylated Anti-Human GRO-beta (CXCL2) | 500-P104Bt-25UG | 25UG |
| Biotinylated Anti-Human MIP-4 (CCL18) | 500-P108Bt-50UG | 50UG |
| Anti-Murine C10 (CCL6) | 500-P112-50UG | 50UG |
| Anti-Murine JE/MCP-1 (CCL2) | 500-P113-100UG | 100UG |
| Biotinylated Anti-Murine Exodus-2 (CCL21) | 500-P114Bt-1MG | 1MG |
| Anti-Murine RANTES (CCL5) | 500-P118-100UG | 100UG |
| Biotinylated Anti-Murine IFN-gamma | 500-P119Bt-1MG | 1MG |
| Anti-Murine MIP-1alpha (CCL3) | 500-P121-1MG | 1MG |
| Biotinylated Anti-Human GCP-2 (CXCL6) | 500-P120Bt-25UG | 25UG |
| Anti-Murine MIP-1alpha (CCL3) | 500-P121-50UG | 50UG |
| Biotinylated Anti-Rat IFN-gamma (Polyclonal Rabbit) | 500-P122Bt-25UG | 25UG |
| Biotinylated Anti-Human MIP-5 (CCL15) | 500-P123GBt-1MG | 1MG |
| Biotinylated Anti-Human LEC (CCL16) | 500-P125GBt-25UG | 25UG |
| Anti-Human NP-1 | 500-P126G-100UG | 100UG |
| Biotinylated Anti-Murine MIP-2 (CXCL2) | 500-P130Bt-25UG | 25UG |
| Anti-Human sRANK Ligand (Polyclonal Rabbit) | 500-P133-100UG | 100UG |
| Biotinylated Anti-Human TECK (CCL25) | 500-P134Bt-25UG | 25UG |
| Anti-Human TWEAK | 500-P137G-50UG | 50UG |
| Anti-Human Persephin | 500-P138-50UG | 50UG |
| Biotinylated Anti-Human BCA-1 (CXCL13) | 500-P141Bt-1MG | 1MG |
| Biotinylated Anti-Human sRANK Receptor | 500-P144Bt-25UG | 25UG |
| Anti-Human sRANK Receptor | 500-P144-100UG | 100UG |
| Biotinylated Anti-Human FGF-10 | 500-P151GBt-50UG | 50UG |
| Biotinylated Anti-Human FGF-17 (Polyclonal Rabbit) | 500-P152Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-4 | 500-P54Bt-1MG | 1MG |
| Anti-Murine IL-4 | 500-P54-1MG | 1MG |
| Biotinylated Anti-Murine IL-9 | 500-P59Bt-25UG | 25UG |
| Biotinylated Anti-Murine sRANK Ligand | 500-P63Bt-50UG | 50UG |
| Biotinylated Anti-Murine TNF-alpha (Polyclonal Rabbit) | 500-P64Bt-1MG | 1MG |
| Anti-Murine Eotaxin (CCL11) | 500-P67-50UG | 50UG |
| Biotinylated Anti-Murine Leptin | 500-P68Bt-25UG | 25UG |
| Anti-Murine Leptin | 500-P68-1MG | 1MG |
| Biotinylated Anti-Murine Eotaxin (CCL11) | 500-P67Bt-1MG | 1MG |
| Anti-Rat TNF-alpha | 500-P72-1MG | 1MG |
| Anti-Murine SCF | 500-P71-50UG | 50UG |
| Anti-Rat MCP-1 (CCL2) | 500-P76-50UG | 50UG |
| Anti-Rat MIP-1alpha (CCL3) | 500-P77-50UG | 50UG |
| Biotinylated Anti-Rat MIP-1alpha (CCL3) | 500-P77Bt-50UG | 50UG |
| Anti-Rat RANTES (CCL5) | 500-P78-50UG | 50UG |
| Anti-Rat IL-1beta | 500-P80-1MG | 1MG |
| Anti-Human GDNF | 500-P81-100UG | 100UG |
| Anti-Human NT-4 | 500-P83G-100UG | 100UG |
| Biotinylated Anti-Human Leptin | 500-P86Bt-25UG | 25UG |
| Anti-Human SDF-1beta (CXCL12) | 500-P87BG-1MG | 1MG |
| Biotinylated Anti-Human IL-17D | 500-P88Bt-25UG | 25UG |
| Anti-Human IL-17E | 500-P89-1MG | 1MG |
| Biotinylated Anti-Human ENA-78 (CXCL5) | 500-P91Bt-50UG | 50UG |
| Biotinylated Anti-Human IP-10 (CXCL10) | 500-P93Bt-50UG | 50UG |
| Biotinylated Anti-Human MIP-3beta (CCL19) | 500-P95BBt-50UG | 50UG |
| Biotinylated Anti-Human MIP-3alpha (CCL20) | 500-P95ABt-25UG | 25UG |
| Anti-Human TARC (CCL17) | 500-P97-1MG | 1MG |
| Biotinylated Anti-Human TARC (CCL17) | 500-P97Bt-50UG | 50UG |
| Anti-Human SCGF-beta | 500-P99G-50UG | 50UG |
| Biotinylated Anti-Human SCGF-beta | 500-P99GBt-50UG | 50UG |
| Biotinylated Anti-Human Cardiotrophin-1 | 500-P101Bt-25UG | 25UG |
| Anti-Human Neurturin | 500-P102-100UG | 100UG |
| Anti-Human Cardiotrophin-1 | 500-P101-1MG | 1MG |
| Biotinylated Anti-Human GRO-beta (CXCL2) | 500-P104Bt-1MG | 1MG |
| Anti-Human Exodus-2 (CCL21) | 500-P109-100UG | 100UG |
| Biotinylated Anti-Human MIP-4 (CCL18) | 500-P108Bt-25UG | 25UG |
| Anti-Murine IL-2 | 500-P111-50UG | 50UG |
| Anti-Murine IL-2 | 500-P111-100UG | 100UG |
| Anti-Murine IL-18BP | 500-P153G-100UG | 100UG |
| Biotinylated Anti-Murine IL-18BP | 500-P153GBt-25UG | 25UG |
| Biotinylated Anti-Murine IL-18BP | 500-P153GBt-50UG | 50UG |
| Biotinylated Anti-Murine IL-12 | 500-P155GBt-1MG | 1MG |
| Anti-Murine IL-12 | 500-P155G-50UG | 50UG |
| Anti-Human Eotaxin-3 (CCL26) | 500-P156G-100UG | 100UG |
| Biotinylated Anti-Murine IGF-I | 500-P157GBt-1MG | 1MG |
| Biotinylated Anti-Human FGF-16 | 500-P160GBt-50UG | 50UG |
| Anti-Human BD-2 | 500-P161G-100UG | 100UG |
| Anti-Human SCGF-alpha | 500-P162-100UG | 100UG |
| Biotinylated Anti-Murine SDF-1alpha (CXCL12) | 500-P164GBt-50UG | 50UG |
| Anti-Human TACI | 500-P166G-50UG | 50UG |
| Anti-Murine SDF-1alpha (CXCL12) | 500-P164G-100UG | 100UG |
| Anti-Human sTNF Receptor Type II | 500-P168-50UG | 50UG |
| Anti-Human 4-1BB Ligand | 500-P169-1MG | 1MG |
| Biotinylated Anti-Human EMAP-II | 500-P172GBt-50UG | 50UG |
| Anti-Human EMAP-II | 500-P172G-100UG | 100UG |
| Anti-Murine EGF | 500-P174G-1MG | 1MG |
| Biotinylated Anti-Murine IL-13 | 500-P178Bt-25UG | 25UG |
| Biotinylated Anti-Human LIGHT | 500-P179Bt-1MG | 1MG |
| Biotinylated Anti-Human Resistin (Polyclonal Rabbit) | 500-P183Bt-50UG | 50UG |
| Anti-Human Resistin (Polyclonal Goat) | 500-P183G-100UG | 100UG |
| Biotinylated Anti-Human Resistin (Polyclonal Goat) | 500-P183GBt-50UG | 50UG |
| Anti-Rat Leptin | 500-P185G-100UG | 100UG |
| Anti-Human LD78beta (CCL3L1) | 500-P187G-100UG | 100UG |
| Biotinylated Anti-Human FGF-basic | 500-P18Bt-25UG | 25UG |
| Anti-Human IL-20 | 500-P190G-100UG | 100UG |
| Biotinylated Anti-Human IL-19 | 500-P189Bt-1MG | 1MG |
| Anti-Human APRIL | 500-P192-1MG | 1MG |
| Biotinylated Anti-Human gAcrp30/Adipolean | 500-P193GBt-50UG | 50UG |
| Biotinylated Anti-Human gAcrp30/Adipolean | 500-P193GBt-25UG | 25UG |
| Anti-Rat SCF | 500-P202-50UG | 50UG |
| Biotinylated Anti-Human Follistatin | 500-P207Bt-1MG | 1MG |
| Anti-Human Galectin-1 | 500-P210-50UG | 50UG |
| Anti-Human CTGFL/WISP-2 | 500-P212-50UG | 50UG |
| Anti-Murine RELMalpha | 500-P214-50UG | 50UG |
| Anti-Human RELMbeta | 500-P217-1MG | 1MG |
| Anti-Human Visfatin | 500-P222-1MG | 1MG |
| Anti-Murine IL-22 | 500-P223-50UG | 50UG |
| Anti-Human IGF-BP5 | 500-P232-50UG | 50UG |
| Anti-Human IGF-BP7 | 500-P234-100UG | 100UG |
| Anti-Human Nanog | 500-P236-100UG | 100UG |
| Biotinylated Anti-Human Nanog | 500-P236Bt-1MG | 1MG |
| Biotinylated Anti-Human ApoE3 | 500-P238Bt-25UG | 25UG |
| Anti-Human Adiponectin | 500-P239-50UG | 50UG |
| Anti-Human CRP | 500-P242-1MG | 1MG |
| Biotinylated Anti-Human MIA | 500-P243Bt-50UG | 50UG |
| Anti-Human MIA | 500-P243-50UG | 50UG |
| Biotinylated Anti-Human IL-31 | 500-P249Bt-25UG | 25UG |
| Biotinylated Anti-Human Wnt-3a | 500-P251Bt-25UG | 25UG |
| Anti-Human IL-12 | 500-P154G-50UG | 50UG |
| Anti-Human Eotaxin-3 (CCL26) | 500-P156G-50UG | 50UG |
| Anti-Human FGF-4 | 500-P158-1MG | 1MG |
| Biotinylated Anti-Human IL-15 | 500-P15Bt-25UG | 25UG |
| Anti-Human BAFF (Polyclonal Rabbit) | 500-P163-1MG | 1MG |
| Biotinylated Anti-Human BAFF (Polyclonal Rabbit) | 500-P163BT-50UG | 50UG |
| Biotinylated Anti-Human TACI | 500-P166GBt-1MG | 1MG |
| Anti-Human sTNF Receptor Type II | 500-P168-100UG | 100UG |
| Biotinylated Anti-Human 4-1BB Ligand | 500-P169Bt-25UG | 25UG |
| Biotinylated Anti-Murine EGF | 500-P174GBt-25UG | 25UG |
| Anti-Murine Eotaxin-2 (CCL24) | 500-P175G-100UG | 100UG |
| Biotinylated Anti-Murine IL-13 | 500-P178Bt-50UG | 50UG |
| Anti-Rat IL-1alpha | 500-P180G-100UG | 100UG |
| Biotinylated Anti-Human sFas Ligand | 500-P184GBt-50UG | 50UG |
| Anti-Human EG-VEGF | 500-P188G-50UG | 50UG |
| Anti-Human EG-VEGF | 500-P188G-1MG | 1MG |
| Biotinylated Anti-Human IL-19 | 500-P189Bt-25UG | 25UG |
| Anti-Human/Murine/Rat BMP-2 | 500-P195-1MG | 1MG |
| Anti-Human gAcrp30/Adipolean Variant | 500-P205-1MG | 1MG |
| Anti-Human CTGFL/WISP-2 | 500-P212-100UG | 100UG |
| Biotinylated Anti-Murine MIP-1beta (CCL4) | 500-P213Bt-25UG | 25UG |
| Biotinylated Anti-Murine RELMalpha | 500-P214Bt-1MG | 1MG |
| Biotinylated Anti-Murine RELMbeta | 500-P215Bt-50UG | 50UG |
| Biotinylated Anti-Human RELMbeta | 500-P217Bt-25UG | 25UG |
| Biotinylated Anti-Human RELMbeta | 500-P217Bt-50UG | 50UG |
| Anti-Murine IL-22 | 500-P223-1MG | 1MG |
| Biotinylated Anti-Rat IL-13 | 500-P224Bt-25UG | 25UG |
| Anti-Rat GM-CSF | 500-P225-100UG | 100UG |
| Biotinylated Anti-Rat GM-CSF | 500-P225Bt-25UG | 25UG |
| Anti-Human sCD22 | 500-P227-1MG | 1MG |
| Anti-Human IGF-BP1 | 500-P228-50UG | 50UG |
| Biotinylated Anti-Human IGF-BP3 | 500-P230Bt-1MG | 1MG |
| Biotinylated Anti-Human IGF-BP1 | 500-P228Bt-50UG | 50UG |
| Biotinylated Anti-Human IGF-BP5 | 500-P232Bt-1MG | 1MG |
| Anti-Human BRAK (CXCL14) | 500-P237-50UG | 50UG |
| Anti-Human Adiponectin | 500-P239-1MG | 1MG |
| Biotinylated Anti-Human Adiponectin | 500-P239BT-50UG | 50UG |
| Anti-Human BD-3 | 500-P241-50UG | 50UG |
| Anti-Human MIA | 500-P243-100UG | 100UG |
| Anti-Human Wnt-3a | 500-P251-1MG | 1MG |
| Anti-Human CTGF | 500-P252-100UG | 100UG |
| Anti-Human BD-1 | 500-P253-100UG | 100UG |
| Anti-Human Betacellulin | 500-P254-50UG | 50UG |
| Biotinylated Anti-Human IL-12 | 500-P154GBt-50UG | 50UG |
| Biotinylated Anti-Human FGF-4 | 500-P158Bt-50UG | 50UG |
| Anti-Human BD-2 | 500-P161G-50UG | 50UG |
| Anti-Murine SDF-1alpha (CXCL12) | 500-P164G-1MG | 1MG |
| Anti-Human 4-1BB Receptor | 500-P167G-50UG | 50UG |
| Biotinylated Anti-Human sTNF Receptor Type II | 500-P168Bt-25UG | 25UG |
| Anti-Human Midkine | 500-P171-1MG | 1MG |
| Biotinylated Anti-Human EMAP-II | 500-P172GBt-25UG | 25UG |
| Anti-Murine EGF | 500-P174G-50UG | 50UG |
| Anti-Murine IL-13 | 500-P178-100UG | 100UG |
| Biotinylated Anti-Human LIGHT | 500-P179Bt-25UG | 25UG |
| Anti-Murine Resistin | 500-P182G-50UG | 50UG |
| Biotinylated Anti-Human Resistin (Polyclonal Goat) | 500-P183GBt-25UG | 25UG |
| Biotinylated Anti-Rat Leptin | 500-P185GBt-25UG | 25UG |
| Biotinylated Anti-Human EG-VEGF | 500-P188GBt-25UG | 25UG |
| Biotinylated Anti-Human IL-19 | 500-P189Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-20 | 500-P190GBt-1MG | 1MG |
| Biotinylated Anti-Human BMP-7 | 500-P198Bt-25UG | 25UG |
| Biotinylated Anti-Murine CXCL16 | 500-P201GBt-1MG | 1MG |
| Anti-Human gAcrp30/Adipolean Variant | 500-P205-100UG | 100UG |
| Biotinylated Anti-Human gAcrp30/Adipolean Variant | 500-P205Bt-1MG | 1MG |
| Biotinylated Anti-Human IL-1RA | 500-P209Bt-50UG | 50UG |
| Anti-Human IL-22 | 500-P211-100UG | 100UG |
| Anti-Murine MIP-1beta (CCL4) | 500-P213-100UG | 100UG |
| Biotinylated Anti-Murine RELMalpha | 500-P214Bt-25UG | 25UG |
| Anti-Human RELMbeta | 500-P217-50UG | 50UG |
| Anti-Rat IL-13 | 500-P224-50UG | 50UG |
| Biotinylated Anti-Human sCD22 | 500-P227Bt-25UG | 25UG |
| Anti-Human IGF-BP3 | 500-P230-50UG | 50UG |
| Anti-Human IGF-BP5 | 500-P232-1MG | 1MG |
| Anti-Human Nanog | 500-P236-50UG | 50UG |
| Anti-Human BRAK (CXCL14) | 500-P237-1MG | 1MG |
| Biotinylated Anti-Human BRAK (CXCL14) | 500-P237Bt-1MG | 1MG |
| Biotinylated Anti-Human Adiponectin | 500-P239BT-1MG | 1MG |
| Biotinylated Anti-Human BD-3 | 500-P241Bt-25UG | 25UG |
| Anti-Human CRP | 500-P242-50UG | 50UG |
| Anti-Human Artemin | 500-P245-1MG | 1MG |
| Anti-Human Galectin-3 | 500-P246-100UG | 100UG |
| Anti-Human IFN-lambda2 | 500-P247-50UG | 50UG |
| Anti-Human IL-31 | 500-P249-1MG | 1MG |
| Anti-Human CTGF | 500-P252-50UG | 50UG |
| Biotinylated Anti-Human CTGF | 500-P252Bt-25UG | 25UG |
| Biotinylated Anti-Murine IGF-I | 500-P157GBt-50UG | 50UG |
| Anti-Human FGF-16 | 500-P160G-100UG | 100UG |
| Biotinylated Anti-Human BD-2 | 500-P161GBt-1MG | 1MG |
| Biotinylated Anti-Human SCGF-alpha | 500-P162BT-1MG | 1MG |
| Anti-Human BAFF (Polyclonal Goat) | 500-P163G-1MG | 1MG |
| Biotinylated Anti-Human TACI | 500-P166GBt-25UG | 25UG |
| Anti-Human sTNF Receptor Type II | 500-P168-1MG | 1MG |
| Anti-Human 4-1BB Ligand | 500-P169-50UG | 50UG |
| Anti-Human EMAP-II | 500-P172G-50UG | 50UG |
| Biotinylated Anti-Human Midkine | 500-P171Bt-1MG | 1MG |
| Anti-Murine IL-15 | 500-P173-50UG | 50UG |
| Anti-Murine EGF | 500-P174G-100UG | 100UG |
| Anti-Murine Eotaxin-2 (CCL24) | 500-P175G-1MG | 1MG |
| Biotinylated Anti-Murine MDC (CCL22) | 500-P176Bt-50UG | 50UG |
| Anti-Rat IL-3beta | 500-P177G-1MG | 1MG |
| Anti-Human LIGHT | 500-P179-50UG | 50UG |
| Anti-Human IL-19 | 500-P189-100UG | 100UG |
| Biotinylated Anti-Human IL-20 | 500-P190GBt-25UG | 25UG |
| Anti-Human IL-21 | 500-P191-100UG | 100UG |
| Biotinylated Anti-Human IL-21 | 500-P191Bt-1MG | 1MG |
| Anti-Human CXCL16 | 500-P200-1MG | 1MG |
| Biotinylated Anti-Rat SCF | 500-P202Bt-50UG | 50UG |
| Biotinylated Anti-Human gAcrp30/Adipolean Variant | 500-P205Bt-50UG | 50UG |
| Biotinylated Anti-Human IL-22 | 500-P211Bt-50UG | 50UG |
| Anti-Murine MIP-1beta (CCL4) | 500-P213-50UG | 50UG |
| Biotinylated Anti-Murine MIP-1beta (CCL4) | 500-P213Bt-50UG | 50UG |
| Anti-Murine RELMbeta | 500-P215-100UG | 100UG |
| Anti-Human Visfatin | 500-P222-50UG | 50UG |
| Anti-Human RELMbeta | 500-P217-100UG | 100UG |
| Biotinylated Anti-Rat IL-13 | 500-P224Bt-1MG | 1MG |
| Biotinylated Anti-Rat GM-CSF | 500-P225Bt-50UG | 50UG |
| Biotinylated Anti-Human IGF-BP5 | 500-P232Bt-25UG | 25UG |
| Biotinylated Anti-Human IGF-BP7 | 500-P234Bt-25UG | 25UG |
| Anti-Human TL-1A | 500-P240-50UG | 50UG |
| Biotinylated Anti-Human TL-1A | 500-P240Bt-25UG | 25UG |
| Anti-Human BD-3 | 500-P241-100UG | 100UG |
| Biotinylated Anti-Human CRP | 500-P242BT-50UG | 50UG |
| Biotinylated Anti-Human AITRL | 500-P244Bt-25UG | 25UG |
| Anti-Human Artemin | 500-P245-50UG | 50UG |
| Anti-Human IL-31 | 500-P249-100UG | 100UG |
| Biotinylated Anti-Human CTGF | 500-P252Bt-1MG | 1MG |
| Anti-Human Vaspin | 500-P256-1MG | 1MG |
| Anti-Human TSLP | 500-P258-50UG | 50UG |
| Anti-Human NOV | 500-P257-1MG | 1MG |
| Biotinylated Anti-Human IL-33 | 500-P261Bt-1MG | 1MG |
| Anti-Human VEGF-B | 500-P267-1MG | 1MG |
| Human SCF Standard ABTS ELISA Development Kit | 900-K34 | 1kit |
| Human MCP-2 (CCL8) Standard ABTS ELISA Development Kit | 900-K41 | 1kit |
| Rat GRO/KC (CXCL1) Standard ABTS ELISA Development Kit | 900-K57 | 1kit |
| Rat RANTES (CCL5) Standard ABTS ELISA Development Kit | 900-K72 | 1kit |
| Human G-CSF Standard ABTS ELISA Development Kit | 900-K77 | 1kit |
| Murine RANTES (CCL5) Standard ABTS ELISA Development Kit | 900-K124 | 1kit |
| Murine MIP-1alpha (CCL3) Standard ABTS ELISA Development Kit | 900-K125 | 1kit |
| Human IL-22 Standard ABTS ELISA Development Kit | 900-K246 | 1kit |
| Human Heregulinbeta-1 Standard ABTS ELISA Development Kit | 900-K316 | 1kit |
| Human TSLP Standard ABTS ELISA Development Kit | 900-K334 | 1kit |
| Murine IL-17A Standard ABTS ELISA Development Kit | 900-K392 | 1kit |
| Murine IL-5 Standard ABTS ELISA Development Kit | 900-K406 | 1kit |
| Human ICAM-1 Standard ABTS ELISA Development Kit | 900-K464 | 1kit |
| Human EGF Mini ABTS ELISA Development Kit | 900-M05 | 1kit |
| Human PDGF-BB Mini ABTS ELISA Development Kit | 900-M04 | 1kit |
| Human TNF-alpha Mini ABTS ELISA Development Kit | 900-M25 | 1kit |
| Human MIP-1alpha (CCL3) Mini ABTS ELISA Development Kit | 900-M35 | 1kit |
| Human Leptin Mini ABTS ELISA Development Kit | 900-M90 | 1kit |
| Murine IFN-gamma Mini ABTS ELISA Development Kit | 900-M98 | 1kit |
| Human sRANK Ligand Mini ABTS ELISA Development Kit | 900-M142 | 1kit |
| Biotinylated Anti-Human Betacellulin | 500-P254Bt-50UG | 50UG |
| Anti-Human MIA-2 | 500-P255-1MG | 1MG |
| Biotinylated Anti-Human MIA-2 | 500-P255Bt-1MG | 1MG |
| Biotinylated Anti-Human NOV | 500-P257Bt-1MG | 1MG |
| Anti-Human Endostatin | 500-P262-100UG | 100UG |
| Anti-Human Neuroserpin | 500-P271-1MG | 1MG |
| Anti-Rat IL-2 | 500-P274-100UG | 100UG |
| Anti-Rat IL-2 | 500-P274-50UG | 50UG |
| Biotinylated Anti-Rat IL-2 | 500-P274Bt-1MG | 1MG |
| Anti-Human PTHrP | 500-P276-100UG | 100UG |
| Biotinylated Anti-Human sFas Receptor | 500-P295Bt-1MG | 1MG |
| Anti-Human VCAM-1 | 500-P300-100UG | 100UG |
| Anti-Rat IL-7 | 500-P310-50UG | 50UG |
| Anti-Human TFF-2 | 500-P312-50UG | 50UG |
| Anti-Rat SDF-1alpha (CXCL12) | 500-P315-50UG | 50UG |
| Anti-Rat SDF-1alpha (CXCL12) | 500-P315-1MG | 1MG |
| Anti-Human EPO | 500-P318-50UG | 50UG |
| Biotinylated Anti-Human BD-5 | 500-P323Bt-50UG | 50UG |
| Biotinylated Anti-Human MMP-3 | 500-P324BT-50UG | 50UG |
| Anti-Human HB-EGF | 500-P329-100UG | 100UG |
| Biotinylated Anti-Human HB-EGF | 500-P329BT-50UG | 50UG |
| TMB ELISA Buffer Kit | 900-T00 | 1kit |
| Human IL-1alpha Standard ABTS ELISA Development Kit | 900-K11 | 1kit |
| Human IL-7 Standard ABTS ELISA Development Kit | 900-K17 | 1kit |
| Murine IL-1beta Standard ABTS ELISA Development Kit | 900-K47 | 1kit |
| Human MCP-1 (CCL2) Standard ABTS ELISA Development Kit | 900-K31 | 1kit |
| Rat MCP-1 (CCL2) Standard ABTS ELISA Development Kit | 900-K59 | 1kit |
| Human IL-17A Standard ABTS ELISA Development Kit | 900-K84 | 1kit |
| Murine KC (CXCL1) Standard ABTS ELISA Development Kit | 900-K127 | 1kit |
| Murine JE/MCP-1 (CCL2) Standard ABTS ELISA Development Kit | 900-K126 | 1kit |
| Human BD-2 Standard ABTS ELISA Development Kit | 900-K172 | 1kit |
| Murine IP-10 (CXCL10) Standard ABTS ELISA Development Kit | 900-K153 | 1kit |
| Murine IL-15 Standard ABTS ELISA Development Kit | 900-K188 | 1kit |
| Murine IL-13 Standard ABTS ELISA Development Kit | 900-K207 | 1kit |
| Human IL-21 Standard ABTS ELISA Development Kit | 900-K226 | 1kit |
| Human IL-17E Standard ABTS ELISA Development Kit | 900-K234 | 1kit |
| Human NOV Standard ABTS ELISA Development Kit | 900-K338 | 1kit |
| Human IL-33 Standard ABTS ELISA Development Kit | 900-K398 | 1kit |
| Human IL-5 Mini ABTS ELISA Development Kit | 900-M15 | 1kit |
| Murine Leptin Mini ABTS ELISA Development Kit | 900-M76 | 1kit |
| Rat IL-6 Mini ABTS ELISA Development Kit | 900-M86 | 1kit |
| Murine IL-12 Mini ABTS ELISA Development Kit | 900-M97 | 1kit |
| Rat IFN-gamma Mini ABTS ELISA Development Kit | 900-M109 | 1kit |
| Human sCD40 Ligand Mini ABTS ELISA Development Kit | 900-M145 | 1kit |
| Murine IL-15 Mini ABTS ELISA Development Kit | 900-M188 | 1kit |
| Anti-Human TSLP | 500-P258-1MG | 1MG |
| Anti-Human IL-33 | 500-P261-50UG | 50UG |
| Biotinylated Anti-Human IL-33 | 500-P261Bt-50UG | 50UG |
| Biotinylated Anti-Human BD-4 | 500-P268Bt-50UG | 50UG |
| Biotinylated Anti-Human BD-4 | 500-P268Bt-25UG | 25UG |
| Anti-Rat IL-2 | 500-P274-1MG | 1MG |
| Anti-Rat VEGF 165 | 500-P275-100UG | 100UG |
| Biotinylated Anti-Human PTHrP | 500-P276Bt-1MG | 1MG |
| Anti-Human sDLL-4 | 500-P279-1MG | 1MG |
| Anti-Human Heregulinbeta-1 | 500-P288-50UG | 50UG |
| Anti-Rat IP-10 (CXCL10) | 500-P290-1MG | 1MG |
| Anti-Human Klotho | 500-P296-100UG | 100UG |
| Biotinylated Anti-Human VCAM-1 | 500-P300Bt-1MG | 1MG |
| Biotinylated Anti-Human TFF-2 | 500-P312Bt-25UG | 25UG |
| Biotinylated Anti-Rat SDF-1alpha (CXCL12) | 500-P315Bt-50UG | 50UG |
| Anti-Human IL-36gamma (IL-1F9) | 500-P316-1MG | 1MG |
| Biotinylated Anti-Human IL-36gamma (IL-1F9) | 500-P316Bt-50UG | 50UG |
| Biotinylated Anti-Human EPO | 500-P318Bt-1MG | 1MG |
| Biotinylated Anti-Human sCD14 | 500-P320Bt-1MG | 1MG |
| Anti-Human BD-5 | 500-P323-1MG | 1MG |
| Anti-Human VAP-1 | 500-P326-1MG | 1MG |
| Biotinylated Anti-Human sCD34 | 500-P327BT-50UG | 50UG |
| Anti-Human Uteroglobin | 500-P330-1MG | 1MG |
| Human Leptin Standard ABTS ELISA Development Kit | 900-K90 | 1kit |
| Human GRO-beta (CXCL2) Standard ABTS ELISA Development Kit | 900-K120 | 1kit |
| Human sCD40 Ligand Standard ABTS ELISA Development Kit | 900-K145 | 1kit |
| Murine MIP-2 (CXCL2) Standard ABTS ELISA Development Kit | 900-K152 | 1kit |
| Human CXCL16 Standard ABTS ELISA Development Kit | 900-K230 | 1kit |
| Human MIA-2 Standard ABTS ELISA Development Kit | 900-K357 | 1kit |
| Rat EGF Standard ABTS ELISA Development Kit | 900-K390 | 1kit |
| Human BD-4 Standard ABTS ELISA Development Kit | 900-K435 | 1kit |
| Human IL-4 Mini ABTS ELISA Development Kit | 900-M14 | 1kit |
| Human IL-10 Mini ABTS ELISA Development Kit | 900-M21 | 1kit |
| Human MCP-2 (CCL8) Mini ABTS ELISA Development Kit | 900-M41 | 1kit |
| Human SCF Mini ABTS ELISA Development Kit | 900-M34 | 1kit |
| Human IL-17E Mini ABTS ELISA Development Kit | 900-M234 | 1kit |
| Human Resistin Mini ABTS ELISA Development Kit | 900-M235 | 1kit |
| Human BD-3 Mini ABTS ELISA Development Kit | 900-M210 | 1kit |
| Anti-Human Betacellulin | 500-P254-1MG | 1MG |
| Anti-Human NOV | 500-P257-50UG | 50UG |
| Anti-Murine SF-20 | 500-P259-1MG | 1MG |
| Biotinylated Anti-Human PAI-1 | 500-P260Bt-50UG | 50UG |
| Biotinylated Anti-Human VEGF-B | 500-P267BT-25UG | 25UG |
| Anti-Human Maspin | 500-P270-100UG | 100UG |
| Biotinylated Anti-Human Maspin | 500-P270Bt-50UG | 50UG |
| Biotinylated Anti-Rat IL-2 | 500-P274Bt-25UG | 25UG |
| Anti-Rat VEGF 165 | 500-P275-50UG | 50UG |
| Anti-Human PTHrP | 500-P276-1MG | 1MG |
| Biotinylated Anti-Rat VEGF 165 | 500-P275Bt-1MG | 1MG |
| Biotinylated Anti-Murine IL-21 | 500-P278Bt-50UG | 50UG |
| Anti-Human TIMP-1 | 500-P280-50UG | 50UG |
| Anti-Human ICAM-1 | 500-P287-50UG | 50UG |
| Anti-Human CTACK (CCL27) | 500-P294-50UG | 50UG |
| Biotinylated Anti-Human sTRAIL Receptor-2 | 500-P299Bt-50UG | 50UG |
| Anti-Murine LIGHT | 500-P308-50UG | 50UG |
| Biotinylated Anti-Murine LIGHT | 500-P308BT-25UG | 25UG |
| Biotinylated Anti-Human Osteopontin | 500-P314Bt-25UG | 25UG |
| Anti-Rat SDF-1alpha (CXCL12) | 500-P315-100UG | 100UG |
| Anti-Human sCD14 | 500-P320-1MG | 1MG |
| Anti-Human Amphiregulin | 500-P322-50UG | 50UG |
| Anti-Human MMP-3 | 500-P324-100UG | 100UG |
| Biotinylated Anti-Human sIL-4 Receptor alpha | 500-P325BT-25UG | 25UG |
| Biotinylated Anti-Human sCD34 | 500-P327BT-25UG | 25UG |
| Anti-Human HB-EGF | 500-P329-1MG | 1MG |
| Biotinylated Anti-Human HB-EGF | 500-P329BT-1MG | 1MG |
| Anti-Human Uteroglobin | 500-P330-50UG | 50UG |
| Biotinylated Anti-Human ApoA-I | 500-P331BT-1MG | 1MG |
| Human PDGF-BB Standard ABTS ELISA Development Kit | 900-K04 | 1kit |
| Human IL-2 Standard ABTS ELISA Development Kit | 900-K12 | 1kit |
| Human IL-5 Standard ABTS ELISA Development Kit | 900-K15 | 1kit |
| Human IFN-gamma Standard ABTS ELISA Development Kit | 900-K27 | 1kit |
| Human NAP-2 (CXCL7) Standard ABTS ELISA Development Kit | 900-K40 | 1kit |
| Rat TNF-alpha Standard ABTS ELISA Development Kit | 900-K73 | 1kit |
| Human MIG (CXCL9) Standard ABTS ELISA Development Kit | 900-K87 | 1kit |
| Human Eotaxin (CCL11) Standard ABTS ELISA Development Kit | 900-K69 | 1kit |
| Human TWEAK Standard ABTS ELISA Development Kit | 900-K149 | 1kit |
| Murine IGF-I Standard ABTS ELISA Development Kit | 900-K170 | 1kit |
| Murine EGF Standard ABTS ELISA Development Kit | 900-K179 | 1kit |
| Human BD-1 Standard ABTS ELISA Development Kit | 900-K202 | 1kit |
| Human BD-3 Standard ABTS ELISA Development Kit | 900-K210 | 1kit |
| Human Betacellulin Standard ABTS ELISA Development Kit | 900-K372 | 1kit |
| Rat VEGF 165 Standard ABTS ELISA Development Kit | 900-K436 | 1kit |
| Human IFN-gamma Mini ABTS ELISA Development Kit | 900-M27 | 1kit |
| Rat GRO/KC (CXCL1) Mini ABTS ELISA Development Kit | 900-M57 | 1kit |
| Murine IL-2 Mini ABTS ELISA Development Kit | 900-M108 | 1kit |
| Murine Exodus-2 (CCL21) Mini ABTS ELISA Development Kit | 900-M132 | 1kit |
| Murine MIP-2 (CXCL2) Mini ABTS ELISA Development Kit | 900-M152 | 1kit |
| Rat IL-2 Mini ABTS ELISA Development Kit | 900-M205 | 1kit |
| Human/Murine/Rat BMP-2 Mini ABTS ELISA Development Kit | 900-M255 | 1kit |
| Murine IL-17A Mini ABTS ELISA Development Kit | 900-M392 | 1kit |
| Human Neuroserpin Mini ABTS ELISA Development Kit | 900-M412 | 1kit |
| Rat EGF Mini ABTS ELISA Development Kit | 900-M390 | 1kit |
| Human MIP-1beta (CCL4) Standard TMB ELISA Development Kit | 900-T36 | 1kit |
| Human IL-2 Mini TMB ELISA Development Kit | 900-TM12 | 1kit |
| Human MIP-1beta (CCL4) Mini TMB ELISA Development Kit | 900-TM36 | 1kit |
| Murine MIP-1beta (CCL4) Mini ABTS ELISA Development Kit | 900-M278 | 1kit |
| Murine IL-22 Mini ABTS ELISA Development Kit | 900-M257 | 1kit |
| Human ICAM-1 Mini ABTS ELISA Development Kit | 900-M464 | 1kit |
| Rat TNF-alpha Mini TMB ELISA Development Kit | 900-TM73 | 1kit |
| Human Dendritic Cell Cytokine Package | HDC | 1Pack |
| Murine IL-5 Mini ABTS ELISA Development Kit | 900-M406 | 1kit |
| Human IL-1alpha Standard TMB ELISA Development Kit | 900-T11 | 1kit |
| Murine IL-10 Mini TMB ELISA Development Kit | 900-TM53 | 1kit |
| Murine Hematopoietic Stem Cell Expansion Cytokine Package (IL-6) | MHSC6 | 1Pack |
| Human IL-4 Standard TMB ELISA Development Kit | 900-T14 | 1kit |
| Human IP-10 (CXCL10) Standard TMB ELISA Development Kit | 900-T39 | 1kit |
| Human IL-4 Mini TMB ELISA Development Kit | 900-TM14 | 1kit |
| Human TNF-alpha Mini TMB ELISA Development Kit | 900-TM25 | 1kit |
| Murine TNF-alpha Mini TMB ELISA Development Kit | 900-TM54 | 1kit |
| Serum Replacement Solution | SR-100 | 100mL |
| Recombinant Human Heregulinbeta-1 | 100-03-500UG | 500UG |
| Human PTHrP | 100-09-500UG | 500UG |
| Human Epiregulin | 100-04-250UG | 250UG |
| Human sCD22 | 100-01-500UG | 500UG |
| Human Epiregulin | 100-04-5UG | 5UG |
| Human Prolactin | 100-07-10UG | 10UG |
| Human/Murine/Rat Myostatin | 120-00-250UG | 250UG |
| Human TSG | 120-09-50UG | 50UG |
| Human Prokineticin-2 | 100-46-20UG | 20UG |
| Human Sclerostin | 100-49-1MG | 1MG |
| Human Klotho | 100-53-1mg | 1MG |
| Human Thrombomodulin | 100-58-100UG | 100UG |
| Human Thrombomodulin | 100-58-1MG | 1MG |
| Human HPRG | 100-60-500UG | 500UG |
| Human Mesothelin | 100-63-10UG | 10UG |
| Human Mesothelin | 100-63-500UG | 500UG |
| Human/Murine/Rat Irisin | 100-65-2UG | 2UG |
| Human p16-INK4a | 110-02-100UG | 100UG |
| Human p16-INK4a-TAT | 110-02T-500UG | 500UG |
| Human Sox2-TAT | 110-03T-500UG | 500UG |
| Human Lin28-TAT | 110-06-100UG | 100UG |
| Human Vimentin | 110-10-250UG | 250UG |
| Human sCD4 | 110-11-50UG | 50UG |
| Human sCD4 | 110-11-1MG | 1MG |
| Human Sclerostin | 100-49-5UG | 5UG |
| Human Sclerostin | 100-49-250UG | 250UG |
| Human Betacellulin | 100-50-20UG | 20UG |
| Human Thrombomodulin | 100-58-250UG | 250UG |
| Human HPRG | 100-60-25UG | 25UG |
| Human MPF | 100-62-10UG | 10UG |
| Human MPF | 100-62-1MG | 1MG |
| Human/Murine/Rat Irisin | 100-65-50UG | 50UG |
| Human sCD14 | 110-01-50UG | 50UG |
| Human p16-INK4a | 110-02-5UG | 5UG |
| Human Sox2-TAT | 110-03T-100UG | 100UG |
| Human Vimentin | 110-10-500UG | 500UG |
| Human/Murine FGF-8b | 100-25-25UG | 25UG |
| Human Amphiregulin | 100-55B-500UG | 500UG |
| Human HPRG | 100-60-1MG | 1MG |
| Human/Murine/Rat Irisin | 100-65-500UG | 500UG |
| Human sCD14 | 110-01-500UG | 500UG |
| Human p16-INK4a | 110-02-500ug | 500UG |
| Human Sox2 | 110-03-250UG | 250UG |
| Human KLF4-TAT | 110-08-25UG | 25UG |
| Human TSG | 120-09-1MG | 1MG |
| Human Myostatin-Propeptide | 120-12-100UG | 100UG |
| Human Wnt-1 | 120-17-2UG | 2UG |
| Human WISP-1 | 120-18-1mg | 1MG |
| Human Nanog | 120-21-500UG | 500UG |
| Human Osteopontin | 120-35-250UG | 250UG |
| Human GDF-7 | 120-37-100UG | 100UG |
| Human GASP-1 | 120-41-1MG | 1MG |
| Human Wnt-9b | 120-49-5UG | 5UG |
| Human sFRP-4 | 120-50-100UG | 100UG |
| Human sFRP-4 | 120-50-1MG | 1MG |
| Human FSTL1 | 120-51-50UG | 50UG |
| Human MIA | 130-01-20UG | 20UG |
| Human MIA-2 | 130-02-100UG | 100UG |
| Human ANG-1 | 130-06-5UG | 5UG |
| Human ANG-2 | 130-07-5UG | 5UG |
| Human Neuroserpin | 130-14-25UG | 25UG |
| Human Neuroserpin | 130-14-1MG | 1MG |
| Human Relaxin-2 | 130-15-1MG | 1MG |
| Human ANGPTL-3 | 130-18-1MG | 1MG |
| Human ANGPTL-7 | 130-22-5UG | 5UG |
| Human PAI-2 | 140-06-100UG | 100UG |
| Human sDLL-1 | 140-08-500UG | 500UG |
| Human VCAM-1 | 150-04-50UG | 50UG |
| Human ICAM-1 | 150-05-250UG | 250UG |
| Human Slit2-N | 150-11-50UG | 50UG |
| Mycoplasma Arginine Deiminase | 150-12-5UG | 5UG |
| Human VAP-1 | 150-16-10UG | 10UG |
| Human Tissue Factor | 150-19T-500UG | 500UG |
| Recombinant Human ICAM-2 Fc | 150-22-250ug | 250ug |
| Human MD-2/LY96 | 160-07-10UG | 10UG |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-100UG | 100UG |
| Human IL-4 | 200-04-500UG | 500UG |
| Human IL-5 | 200-05-250UG | 250UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-50UG | 50UG |
| Human WISP-1 | 120-18-500UG | 500UG |
| Human Nanog | 120-21-250UG | 250UG |
| Human Nanog-TAT | 120-21B-1MG | 1MG |
| Human GDF-7 | 120-37-1MG | 1MG |
| Human GASP-1 | 120-41-5UG | 5UG |
| Human GASP-1 | 120-41-500UG | 500UG |
| Human Gremlin-1 | 120-42-100UG | 100UG |
| Human DKK-2 | 120-45-2UG | 2UG |
| Human DKK-3 | 120-46-10UG | 10UG |
| Human FSTL1 | 120-51-1MG | 1MG |
| Recombinant Human sFRP-5 | 120-53-10ug | 10ug |
| Human FSTL1 | 120-51-250UG | 250UG |
| Human MIA | 130-01-5UG | 5UG |
| Human MIA | 130-01-1MG | 1MG |
| Human INSL5/INSL7 Hybrid | 130-05-25UG | 25UG |
| Human ANG-2 | 130-07-250UG | 250UG |
| Human GLP-1 | 130-08-200UG | 200UG |
| Human Relaxin-3 | 130-10-250UG | 250UG |
| Human Vaspin | 130-11-25UG | 25UG |
| Human ANGPTL-3 | 130-18-500UG | 500UG |
| Human C1 Inhibitor | 130-20-200UG | 200UG |
| Murine Granzyme B | 140-03-100UG | 100UG |
| Human Fetuin A/AHSG | 140-13-500UG | 500UG |
| Human VCAM-1 | 150-04-10UG | 10UG |
| Human Endostatin | 150-01-1MG | 1MG |
| Human ICAM-1 | 150-05-50UG | 50UG |
| Human Slit2-N | 150-11-25UG | 25UG |
| Human TIGAR | 150-14-1MG | 1MG |
| Human E-Selectin | 150-15-10UG | 10UG |
| Human E-Selectin | 150-15-500UG | 500UG |
| Human VAP-1 | 150-16-100UG | 100UG |
| Human ROR1 | 160-04-20UG | 20UG |
| Human MD-2/LY96 | 160-07-250UG | 250UG |
| Human IL-3 | 200-03-2UG | 2UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-1MG | 1MG |
| Human IL-6 | 200-06-250UG | 250UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-20UG | 20UG |
| Human sIL-6 Receptor alpha (CHO derived) | 200-06RC-500UG | 500UG |
| Human Wnt-1 | 120-17-10UG | 10UG |
| Human Wnt-1 | 120-17-1MG | 1MG |
| Human WISP-3 | 120-20-100UG | 100UG |
| Human Nanog | 120-21-20UG | 20UG |
| Human Nanog-TAT | 120-21B-100UG | 100UG |
| Human Osteopontin | 120-35-500UG | 500UG |
| Human GASP-1 | 120-41-100UG | 100UG |
| Human Wnt-9b | 120-49-1mg | 1MG |
| Human FSTL1 | 120-51-500UG | 500UG |
| Human MIA | 130-01-250UG | 250UG |
| Human OTOR | 130-03-1MG | 1MG |
| Human ANG-1 | 130-06-100UG | 100UG |
| Human ANG-2 | 130-07-20UG | 20UG |
| Human GLP-1 | 130-08-5MG | 5MG |
| Human Relaxin-3 | 130-10-1MG | 1MG |
| Human Maspin | 130-12-20UG | 20UG |
| Human Neuroserpin | 130-14-100UG | 100UG |
| Human Relaxin-2 | 130-15-500UG | 500UG |
| Human C1 Inhibitor | 130-20-50UG | 50UG |
| Murine Granzyme B | 140-03-500UG | 500UG |
| Human PAI-2 | 140-06-2UG | 2UG |
| Human sDLL-1 | 140-08-5UG | 5UG |
| Human PAF-AH | 140-10-250UG | 250UG |
| Human VCAM-1 | 150-04-100UG | 100UG |
| Human PECAM-1 | 150-06-50UG | 50UG |
| Mycoplasma Arginine Deiminase | 150-12-20UG | 20UG |
| Mycoplasma Arginine Deiminase | 150-12-500UG | 500UG |
| Human TIGAR | 150-14-100UG | 100UG |
| Human TIGAR-TAT | 150-14T-500UG | 500UG |
| Human Uteroglobin | 150-18-1MG | 1MG |
| Human Tissue Factor | 150-19T-1MG | 1MG |
| Recombinant Human ICAM-2 Fc | 150-22-100ug | 100ug |
| Human TLR-3 | 160-01-1mg | 1MG |
| Human MD-2/LY96 | 160-07-1MG | 1MG |
| Human IL-1alpha | 200-01A-50UG | 50UG |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-250UG | 250UG |
| Human IL-5 | 200-05-10UG | 10UG |
| Human Wnt-1 | 120-17-500UG | 500UG |
| Human WISP-3 | 120-20-500ug | 500UG |
| Human DKK-1 | 120-30-10UG | 10UG |
| Human DKK-1 | 120-30-500UG | 500UG |
| Human Osteopontin | 120-35-50UG | 50UG |
| Human Osteopontin | 120-35-1MG | 1MG |
| Human Gremlin-1 | 120-42-1mg | 1MG |
| Human DKK-3 | 120-46-2UG | 2UG |
| Human sFRP-4 | 120-50-500UG | 500UG |
| Human FSTL1 | 120-51-100UG | 100UG |
| Recombinant Human sFRP-5 | 120-53-1mg | 1mg |
| Human MIA-2 | 130-02-5UG | 5UG |
| Human Relaxin-3 | 130-10-100UG | 100UG |
| Human Vaspin | 130-11-100UG | 100UG |
| Human Maspin | 130-12-100UG | 100UG |
| Human Relaxin-2 | 130-15-250UG | 250UG |
| Human ANGPTL-3 | 130-18-100UG | 100UG |
| Human ANGPTL-3 | 130-18-250UG | 250UG |
| Human PAI-1 | 140-04-2UG | 2UG |
| Human PAI-1 | 140-04-250UG | 250UG |
| Human PAI-2 | 140-06-10UG | 10UG |
| Human PAI-2 | 140-06-1mg | 1MG |
| Human ICAM-1 | 150-05-10UG | 10UG |
| Human ICAM-1 | 150-05-1MG | 1MG |
| Human TIGAR | 150-14-250UG | 250UG |
| Human TIGAR-TAT | 150-14T-100UG | 100UG |
| Human VAP-1 | 150-16-500UG | 500UG |
| Human Uteroglobin | 150-18-100UG | 100UG |
| Recombinant Human ICAM-2 Fc | 150-22-10ug | 10ug |
| Human TLR-4 | 160-06-10UG | 10UG |
| Human MD-2/LY96 | 160-07-100UG | 100UG |
| Human IL-1alpha | 200-01A-1MG | 1MG |
| Human IL-1RA | 200-01Ra-500UG | 500UG |
| Human sIL-2 Receptor alpha (CHO derived) | 200-02RC-500UG | 500UG |
| Human sIL-4 Receptor alpha (CHO derived) | 200-04RC-500UG | 500UG |
| Human IL-9 | 200-09-10UG | 10UG |
| Human IL-10 | 200-10-2UG | 2UG |
| Human IL-9 | 200-09-100UG | 100UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-100UG | 100UG |
| Murine IL-5 | 215-15-1MG | 1MG |
| Murine RANTES (CCL5) | 250-07-500UG | 500UG |
| Murine MCP-3 (CCL7) | 250-08-100UG | 100UG |
| Murine MIP-2 (CXCL2) | 250-15-100UG | 100UG |
| Murine MIG (CXCL9) | 250-18-20UG | 20UG |
| Murine SDF-1alpha (CXCL12) | 250-20A-50UG | 50UG |
| Murine SDF-1beta (CXCL12) | 250-20B-500UG | 500UG |
| Murine Eotaxin-2 (CCL24) | 250-22-100UG | 100UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-1MG | 1MG |
| Murine Neuropoietin | 250-25B-5UG | 5UG |
| Murine CTACK (CCL27) | 250-26-100UG | 100UG |
| Murine MIP-3alpha (CCL20) | 250-27-500UG | 500UG |
| Murine CXCL16 | 250-28-500UG | 500UG |
| Murine MEC (CCL28) | 250-30-20UG | 20UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-25UG | 25UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-5UG | 5UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-500UG | 500UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-250UG | 250UG |
| Human IL-9 | 200-09-250UG | 250UG |
| Human IL-10 | 200-10-500UG | 500UG |
| Human IL-12 p70 (CHO derived) | 200-12-50UG | 50UG |
| Human IL-12 p80 | 200-12P80H-10UG | 10UG |
| Human IL-13 Variant | 200-13A-500UG | 500UG |
| Human IL-13 Variant | 200-13A-2UG | 2UG |
| Human IL-17A | 200-17-5UG | 5UG |
| Human IL-18BP Fc | 200-18BP-1MG | 1MG |
| Human IL-19 | 200-19-250UG | 250UG |
| Human IL-22 | 200-22-2UG | 2UG |
| Human IL-17E | 200-24-1mg | 1MG |
| Human IL-17D | 200-27-500UG | 500UG |
| Human IL-34 | 200-34-50UG | 50UG |
| Human IL-36beta (IL-1F8) | 200-36B-10UG | 10UG |
| Human IL-36RA | 200-36RA-5UG | 5UG |
| Human IL-27 | 200-38-500UG | 500UG |
| Murine IL-12 p70 | 210-12-100UG | 100UG |
| Murine IL-12 p80 | 210-12P80H-250ug | 250UG |
| Murine IL-15 | 210-15-250UG | 250UG |
| Murine IL-17D | 210-17D-25UG | 25UG |
| Murine IL-17D | 210-17D-100UG | 100UG |
| Murine IL-17E | 210-17E-100UG | 100UG |
| Murine IL-17F | 210-17F-50UG | 50UG |
| Murine IL-31 | 210-31-100UG | 100UG |
| Murine IL-6 | 216-16-250UG | 250UG |
| Murine IL-6 | 216-16-500UG | 500UG |
| Murine IL-9 | 219-19-1MG | 1MG |
| Murine Eotaxin (CCL11) | 250-01-5UG | 5UG |
| Murine Eotaxin (CCL11) | 250-01-500UG | 500UG |
| Murine MCP-5 (CCL12) | 250-04-5UG | 5UG |
| Murine G-CSF | 250-05-10UG | 10UG |
| Murine C10 (CCL6) | 250-06-100UG | 100UG |
| Murine MCP-3 (CCL7) | 250-08-500UG | 500UG |
| Murine MIP-1alpha (CCL3) | 250-09-100UG | 100UG |
| Murine MIP-1alpha (CCL3) | 250-09-50UG | 50UG |
| Murine JE/MCP-1 (CCL2) | 250-10-250UG | 250UG |
| Murine JE/MCP-1 (CCL2) | 250-10-1MG | 1MG |
| Murine MIP-1gamma (CCL9/10) | 250-12-1MG | 1MG |
| Murine Exodus-2 (CCL21) | 250-13-20UG | 20UG |
| Murine MCP-2 (CCL8) | 250-14-100UG | 100UG |
| Murine MIP-2 (CXCL2) | 250-15-250UG | 250UG |
| Murine MIP-2 (CXCL2) | 250-15-1MG | 1MG |
| Murine IP-10 (CXCL10) | 250-16-500UG | 500UG |
| Murine MIG (CXCL9) | 250-18-100UG | 100UG |
| Murine SDF-1beta (CXCL12) | 250-20B-1MG | 1MG |
| Murine Eotaxin-2 (CCL24) | 250-22-250UG | 250UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-100UG | 100UG |
| Murine Cardiotrophin-1 | 250-25-2UG | 2UG |
| Murine Neuropoietin | 250-25B-25UG | 25UG |
| Murine MIP-3alpha (CCL20) | 250-27-20UG | 20UG |
| Murine MIP-3alpha (CCL20) | 250-27-1MG | 1MG |
| Murine CXCL16 | 250-28-25UG | 25UG |
| Murine I-TAC (CXCL11) | 250-29-250UG | 250UG |
| Murine MEC (CCL28) | 250-30-100UG | 100UG |
| Murine IFN-lambda2 | 250-33-5UG | 5UG |
| Murine IFN-lambda2 | 250-33-250UG | 250UG |
| Murine IFN-lambda2 | 250-33-500UG | 500UG |
| Human IL-8 (CXCL8) (77 a.a.) | 200-08-100UG | 100UG |
| Human IL-9 | 200-09-500UG | 500UG |
| Human IL-10 | 200-10-10UG | 10UG |
| Human IL-11 | 200-11-2UG | 2UG |
| Human IL-11 | 200-11-1MG | 1MG |
| Human IL-11 | 200-11-100UG | 100UG |
| Human IL-12 p70 (HEK293 derived) | 200-12H-2UG | 2UG |
| Human IL-12 p80 | 200-12P80H-50UG | 50UG |
| Human IL-13 | 200-13-250UG | 250UG |
| Human IL-23 | 200-23-10UG | 10UG |
| Human IL-17E | 200-24-100UG | 100UG |
| Human IL-17D | 200-27-25UG | 25UG |
| Human IL-17D | 200-27-1MG | 1MG |
| Human IL-31 | 200-31-50UG | 50UG |
| Human IL-31 | 200-31-500UG | 500UG |
| Human IL-33 | 200-33-250UG | 250UG |
| Human IL-24 | 200-35-50UG | 50UG |
| Human IL-24 | 200-35-1MG | 1MG |
| Human IL-36beta (IL-1F8) | 200-36B-250UG | 250UG |
| Human IL-36RA | 200-36RA-250UG | 250UG |
| Human IL-35 | 200-37-50UG | 50UG |
| Human IL-37 (IL-1F7) | 200-39-250UG | 250UG |
| Human IL-37 (IL-1F7) | 200-39-1MG | 1MG |
| Murine IL-12 p40 | 210-12P40H-10UG | 10UG |
| Murine IL-12 p80 | 210-12P80H-2UG | 2UG |
| Murine IL-13 | 210-13-1MG | 1MG |
| Murine IL-17D | 210-17D-250UG | 250UG |
| Murine IL-17D | 210-17D-500UG | 500UG |
| Murine IL-21 | 210-21-250UG | 250UG |
| Murine SF-20 | 210-25-250UG | 250UG |
| Murine IL-31 | 210-31-250UG | 250UG |
| Murine IL-31 | 210-31-1MG | 1MG |
| Murine IL-1beta | 211-11B-100UG | 100UG |
| Murine IL-4 | 214-14-250UG | 250UG |
| Murine IL-4 | 214-14-1MG | 1MG |
| Murine IL-11 | 220-11-500UG | 500UG |
| Murine C10 (CCL6) | 250-06-250UG | 250UG |
| Murine MCP-3 (CCL7) | 250-08-1MG | 1MG |
| Murine MIP-1gamma (CCL9/10) | 250-12-250UG | 250UG |
| Murine Exodus-2 (CCL21) | 250-13-5UG | 5UG |
| Murine MCP-2 (CCL8) | 250-14-250UG | 250UG |
| Murine MIP-2 (CXCL2) | 250-15-20UG | 20UG |
| Murine IP-10 (CXCL10) | 250-16-1MG | 1MG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-500UG | 500UG |
| Murine MIG (CXCL9) | 250-18-1MG | 1MG |
| Murine SDF-1alpha (CXCL12) | 250-20A-100UG | 100UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-5UG | 5UG |
| Murine BCA-1/BLC (CXCL13) | 250-24-250UG | 250UG |
| Murine CTACK (CCL27) | 250-26-500UG | 500UG |
| Murine MEC (CCL28) | 250-30-250UG | 250UG |
| Murine MIP-1beta (CCL4) | 250-32-10UG | 10UG |
| Murine MIP-1beta (CCL4) | 250-32-500UG | 500UG |
| Murine IFN-lambda2 | 250-33-20UG | 20UG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-500UG | 500UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-50UG | 50UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-100UG | 100UG |
| Human IL-8 (CXCL8) (72 a.a.) | 200-08M-1MG | 1MG |
| Human IL-10 | 200-10-1MG | 1MG |
| Human IL-13 Variant | 200-13A-1MG | 1MG |
| Human IL-17A | 200-17-1MG | 1MG |
| Human IL-18BP Fc | 200-18BP-250UG | 250UG |
| Human IL-20 | 200-20-250UG | 250UG |
| Human IL-20 | 200-20-100UG | 100UG |
| Human IL-22 | 200-22-500UG | 500UG |
| Human IL-23 | 200-23-100UG | 100UG |
| Human IL-34 | 200-34-250UG | 250UG |
| Human IL-34 | 200-34-1mg | 1MG |
| Human IL-36alpha (IL-1F6) | 200-36A-500UG | 500UG |
| Human IL-36gamma (IL-1F9) | 200-36G-100UG | 100UG |
| Human IL-36gamma (IL-1F9) | 200-36G-250UG | 250UG |
| Human IL-36RA | 200-36RA-1MG | 1MG |
| Human IL-37 (IL-1F7) | 200-39-25UG | 25UG |
| Murine IL-10 | 210-10-1MG | 1MG |
| Murine IL-12 p80 | 210-12P80H-1mg | 1MG |
| Murine IL-17A | 210-17-250UG | 250UG |
| Murine IL-17E | 210-17E-250UG | 250UG |
| Murine IL-17F | 210-17F-500UG | 500UG |
| Murine SF-20 | 210-25-500UG | 500UG |
| Murine IL-33 | 210-33-1mg | 1MG |
| Murine IL-36RA | 210-36RA-1MG | 1MG |
| Murine IL-1beta | 211-11B-50UG | 50UG |
| Murine IL-6 | 216-16-1MG | 1MG |
| Murine IL-9 | 219-19-250UG | 250UG |
| Murine IL-11 | 220-11-250UG | 250UG |
| Murine SCF | 250-03-2UG | 2UG |
| Murine C10 (CCL6) | 250-06-500UG | 500UG |
| Murine RANTES (CCL5) | 250-07-250UG | 250UG |
| Murine MCP-3 (CCL7) | 250-08-250UG | 250UG |
| Murine KC (CXCL1) | 250-11-250UG | 250UG |
| Murine LIX (CXCL6) (92 a.a.) | 250-17-250UG | 250UG |
| Murine SDF-1alpha (CXCL12) | 250-20A-250UG | 250UG |
| Murine Neuropoietin | 250-25B-250UG | 250UG |
| Murine CTACK (CCL27) | 250-26-20UG | 20UG |
| Murine MIP-3alpha (CCL20) | 250-27-250UG | 250UG |
| Murine MIP-3beta (CCL19) | 250-27B-20UG | 20UG |
| Murine CXCL16 | 250-28-250UG | 250UG |
| Murine I-TAC (CXCL11) | 250-29-20UG | 20UG |
| Murine MEC (CCL28) | 250-30-500UG | 500UG |
| Murine MIP-1beta (CCL4) | 250-32-1MG | 1MG |
| Murine LIX (CXCL6) (70 a.a.) | 250-36-100UG | 100UG |
| Murine BD-3 | 250-41-20UG | 20UG |
| Murine BD-3 | 250-41-250UG | 250UG |
| Murine BRAK (CXCL14) | 250-45-20UG | 20UG |
| Human TNF-alpha | 300-01A-250UG | 250UG |
| Human IFN-gamma | 300-02-250UG | 250UG |
| Human MIP-3alpha (CCL20) | 300-29A-100UG | 100UG |
| Human MIP-3beta (CCL19) | 300-29B-50UG | 50UG |
| Human MIP-4 (CCL18) | 300-34-250UG | 250UG |
| Human Exodus-2 (CCL21) | 300-35A-500UG | 500UG |
| Human MDC (CCL22) (67 a.a.) | 300-36-100UG | 100UG |
| Human MDC (CCL22) (69 a.a.) | 300-36A-500UG | 500UG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-2UG | 2UG |
| Human HCC-1 (CCL14) (66 a.a.) | 300-38B-500UG | 500UG |
| Human HCC-1 (CCL14) (66 a.a.) | 300-38B-100UG | 100UG |
| Human MIP-5 (CCL15) | 300-43-250UG | 250UG |
| Human I-TAC (CXCL11) | 300-46-50UG | 50UG |
| Human BCA-1 (CXCL13) | 300-47-100UG | 100UG |
| Human BD-2 | 300-49-250UG | 250UG |
| Human BD-1 (36 a.a.) | 300-51-100UG | 100UG |
| Human BRAK (CXCL14) | 300-50-500UG | 500UG |
| Human BD-3 | 300-52-100UG | 100UG |
| Human Apo-SAA1 | 300-53-100UG | 100UG |
| Human CTACK (CCL27) | 300-54-500UG | 500UG |
| Human CXCL16 | 300-55-100UG | 100UG |
| Human CXCL16 | 300-55-250UG | 250UG |
| Human LAG-1 (CCL4L1) | 300-58-20UG | 20UG |
| Human MEC (CCL28) | 300-57-1mg | 1MG |
| Human TFF-2 | 300-59-100UG | 100UG |
| Human TFF-3 | 300-61-100UG | 100UG |
| Human BD-5 | 300-68-250UG | 250UG |
| Human MIF | 300-69-25UG | 25UG |
| Murine BD-2 | 250-40-100UG | 100UG |
| Murine BD-3 | 250-41-500UG | 500UG |
| Murine TARC (CCL17) | 250-43-500UG | 500UG |
| Human IFN-omega | 300-02J-250UG | 250UG |
| Human MIP-1alpha (CCL3) | 300-08-50UG | 50UG |
| Human MIP-1beta (CCL4) | 300-09-500UG | 500UG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-100UG | 100UG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-5UG | 5UG |
| Human IP-10 (CXCL10) | 300-12-25UG | 25UG |
| Human Apo-SAA | 300-13-100UG | 100UG |
| Human MCP-2 (CCL8) | 300-15-100UG | 100UG |
| Human MCP-2 (CCL8) | 300-15-1MG | 1MG |
| Human Lymphotactin (XCL1) | 300-20-250UG | 250UG |
| Human Eotaxin (CCL11) | 300-21-500UG | 500UG |
| Human ENA-78 (CXCL5) (8-78 a.a.) | 300-22B-5UG | 5UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-500UG | 500UG |
| Human MCP-4 (CCL13) | 300-24-250UG | 250UG |
| Human MIG (CXCL9) | 300-26-500UG | 500UG |
| Human Leptin Receptor | 300-27R-250UG | 250UG |
| Human SDF-1beta (CXCL12) | 300-28B-10UG | 10UG |
| Human SDF-1beta (CXCL12) | 300-28B-100UG | 100UG |
| Human MIP-3beta (CCL19) | 300-29B-500UG | 500UG |
| Human TARC (CCL17) | 300-30-250UG | 250UG |
| Human Fractalkine (CX3CL1) | 300-31-500UG | 500UG |
| Human Cardiotrophin-1 | 300-32-1MG | 1MG |
| Human MIP-4 (CCL18) | 300-34-500UG | 500UG |
| Human Exodus-2 (CCL21) | 300-35A-1MG | 1MG |
| Human MDC (CCL22) (67 a.a.) | 300-36-250UG | 250UG |
| Human I-309 (CCL1) | 300-37-100UG | 100UG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-250UG | 250UG |
| Human NP-1 | 300-42-100UG | 100UG |
| Human LEC (CCL16) | 300-44-5UG | 5UG |
| Human LEC (CCL16) | 300-44-500UG | 500UG |
| Human I-TAC (CXCL11) | 300-46-100UG | 100UG |
| Human Eotaxin-3 (CCL26) | 300-48-500UG | 500UG |
| Human BRAK (CXCL14) | 300-50-250UG | 250UG |
| Human Apo-SAA1 | 300-53-1mg | 1MG |
| Human LAG-1 (CCL4L1) | 300-58-1MG | 1MG |
| Human TFF-2 | 300-59-250UG | 250UG |
| Human TFF-1 | 300-60-20UG | 20UG |
| Human BD-4 | 300-65-20UG | 20UG |
| Human Chemerin | 300-66-500UG | 500UG |
| Human MIF | 300-69-100UG | 100UG |
| Human C5a | 300-70-250ug | 250UG |
| Murine TARC (CCL17) | 250-43-100UG | 100UG |
| Murine TARC (CCL17) | 250-43-1MG | 1MG |
| Human TNF-alpha | 300-01A-1MG | 1MG |
| Human IFN-beta | 300-02BC-1mg | 1MG |
| Human IFN-lambda1 | 300-02L-20UG | 20UG |
| Human RANTES (CCL5) | 300-06-50UG | 50UG |
| Human RANTES (CCL5) | 300-06-1MG | 1MG |
| Human MIP-1beta (CCL4) | 300-09-50UG | 50UG |
| Human MIP-1beta (CCL4) | 300-09-100UG | 100UG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-2UG | 2UG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-1MG | 1MG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-1MG | 1MG |
| Human Apo-SAA | 300-13-50UG | 50UG |
| Human NAP-2 (CXCL7) | 300-14-50UG | 50UG |
| Human MCP-2 (CCL8) | 300-15-2UG | 2UG |
| Recombinant Human PF-4 (CXCL4) | 300-16-20UG | 20UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-5UG | 5UG |
| Human ENA-78 (CXCL5) (5-78 a.a.) | 300-22-250UG | 250UG |
| Human MCP-4 (CCL13) | 300-24-20UG | 20UG |
| Human MCP-4 (CCL13) | 300-24-5UG | 5UG |
| Human SDF-1alpha (CXCL12) | 300-28A-2UG | 2UG |
| Human SDF-1alpha (CXCL12) | 300-28A-250UG | 250UG |
| Human MIP-3 (CCL23) | 300-29-100UG | 100UG |
| Human MIP-3beta (CCL19) | 300-29B-5UG | 5UG |
| Human MIP-3beta (CCL19) | 300-29B-1mg | 1MG |
| Human Cardiotrophin-1 | 300-32-2UG | 2UG |
| Human Eotaxin-2 (CCL24) | 300-33-50UG | 50UG |
| Human MIP-4 (CCL18) | 300-34-100UG | 100UG |
| Human MDC (CCL22) (67 a.a.) | 300-36-20UG | 20UG |
| Human HCC-1 (CCL14) (66 a.a.) | 300-38B-250UG | 250UG |
| Human GRO-beta (CXCL2) | 300-39-100UG | 100UG |
| Human GRO-gamma (CXCL3) | 300-40-1MG | 1MG |
| Human NP-1 | 300-42-500UG | 500UG |
| Human MIP-5 (CCL15) | 300-43-1MG | 1MG |
| Human TECK (CCL25) | 300-45-1MG | 1MG |
| Human TECK (CCL25) | 300-45-100UG | 100UG |
| Human I-TAC (CXCL11) | 300-46-500UG | 500UG |
| Human Eotaxin-3 (CCL26) | 300-48-250UG | 250UG |
| Human BD-1 (36 a.a.) | 300-51-5UG | 5UG |
| Human BD-1 (36 a.a.) | 300-51-1MG | 1MG |
| Human BD-1 (47 a.a.) | 300-51A-250UG | 250UG |
| Human BD-3 | 300-52-20UG | 20UG |
| Human CXCL16 | 300-55-25UG | 25UG |
| Human LD78beta (CCL3L1) | 300-56-250UG | 250UG |
| Human MEC (CCL28) | 300-57-20UG | 20UG |
| Human TFF-2 | 300-59-1MG | 1MG |
| Human TSLP | 300-62-1MG | 1MG |
| Human C5a | 300-70-500ug | 500UG |
| Human TNF-beta | 300-01B-50UG | 50UG |
| Human TNF-beta | 300-01B-1mg | 1MG |
| Human GM-CSF | 300-03-5UG | 5UG |
| Human MCP-1 (CCL2) | 300-04-100UG | 100UG |
| Human MIP-1beta (CCL4) | 300-09-10UG | 10UG |
| Recombinant Human Oncostatin M (227 a.a.) | 300-10-500UG | 500UG |
| Recombinant Human Oncostatin M (209 a.a.) | 300-10T-50UG | 50UG |
| Recombinant Human Oncostatin M (196 a.a.) | 300-10H-100UG | 100UG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-25UG | 25UG |
| Human GRO-alpha/MGSA (CXCL1) | 300-11-500UG | 500UG |
| Human TPO | 300-18-1MG | 1MG |
| Human Lymphotactin (XCL1) | 300-20-500UG | 500UG |
| Human Eotaxin (CCL11) | 300-21-1MG | 1MG |
| Human MCP-4 (CCL13) | 300-24-500UG | 500UG |
| Human MIG (CXCL9) | 300-26-5UG | 5UG |
| Human Leptin Receptor | 300-27R-1MG | 1MG |
| Human SDF-1alpha (CXCL12) | 300-28A-100UG | 100UG |
| Human MIP-3alpha (CCL20) | 300-29A-20UG | 20UG |
| Human MIP-3alpha (CCL20) | 300-29A-500UG | 500UG |
| Human MIP-3beta (CCL19) | 300-29B-20UG | 20UG |
| Human TARC (CCL17) | 300-30-20UG | 20UG |
| Human TARC (CCL17) | 300-30-1MG | 1MG |
| Human Fractalkine (CX3CL1) | 300-31-50UG | 50UG |
| Human Eotaxin-2 (CCL24) | 300-33-500UG | 500UG |
| Human HCC-1 (CCL14) (72 a.a.) | 300-38-100UG | 100UG |
| Human NP-1 | 300-42-250UG | 250UG |
| Human MIP-5 (CCL15) | 300-43-25UG | 25UG |
| Human TECK (CCL25) | 300-45-5UG | 5UG |
| Human BCA-1 (CXCL13) | 300-47-20UG | 20UG |
| Human BCA-1 (CXCL13) | 300-47-250UG | 250UG |
| Human BD-2 | 300-49-5UG | 5UG |
| Human BD-2 | 300-49-20UG | 20UG |
| Human BD-1 (47 a.a.) | 300-51A-100UG | 100UG |
| Human CTACK (CCL27) | 300-54-5UG | 5UG |
| Human LD78beta (CCL3L1) | 300-56-100UG | 100UG |
| Human MEC (CCL28) | 300-57-500ug | 500UG |
| Human TFF-2 | 300-59-5UG | 5UG |
| Human TFF-3 | 300-61-500UG | 500UG |
| Human TSLP | 300-62-500UG | 500UG |
| Human TFF-3 | 300-61-1MG | 1MG |
| Human BD-5 | 300-68-20UG | 20UG |
| Human sCD40 Ligand | 310-02-250UG | 250UG |
| Human CTLA-4 Fc | 310-05-200UG | 200UG |
| Human sRANK Receptor | 310-08-20UG | 20UG |
| Human APRIL | 310-10C-1mg | 1MG |
| Recombinant Human sTRAIL Receptor-2 | 310-19-1MG | 1MG |
| Human TWEAK Receptor | 310-21-100UG | 100UG |
| Human AITRL | 310-22-5UG | 5UG |
| Human AITRL | 310-22-250UG | 250UG |
| Human GITR/TNFRSF18 Fc | 310-22R-100UG | 100UG |
| Human HVEM-Fc | 310-27-100UG | 100UG |
| Human sOX40 Ligand | 310-28-2UG | 2UG |
| Human sCD100 | 310-29-20UG | 20UG |
| Human sCD100 | 310-29-1MG | 1MG |
| Human sCD34 | 310-31-250UG | 250UG |
| Human B7-2 Fc | 310-33-1MG | 1MG |
| Human B7-H2 Fc | 310-37-20UG | 20UG |
| Human PD-L2 Fc | 310-38-1MG | 1MG |
| Human sCD8alpha | 310-41-500UG | 500UG |
| Human TMIGD2/CD28H Fc | 310-42-100UG | 100UG |
| Human TMIGD2/CD28H Fc | 310-42-250UG | 250UG |
| Murine IFN-gamma | 315-05-250UG | 250UG |
| Murine APRIL | 315-13-100UG | 100UG |
| Murine APRIL | 315-13-1MG | 1MG |
| Murine PDGF-BB | 315-18-10UG | 10UG |
| Murine Midkine | 315-25-20UG | 20UG |
| Murine Midkine | 315-25-1MG | 1MG |
| Murine TFF-2 | 315-30-250UG | 250UG |
| Murine VCAM-1 | 315-37-100UG | 100UG |
| Human TACI | 310-17-5UG | 5UG |
| Recombinant Human sTRAIL Receptor-1 | 310-18-1MG | 1MG |
| Recombinant Human sTRAIL Receptor-2 | 310-19-100UG | 100UG |
| Human sFas Receptor | 310-20-5UG | 5UG |
| Human AITRL | 310-22-500UG | 500UG |
| Human GITR/TNFRSF18 Fc | 310-22R-250UG | 250UG |
| Human TL-1A | 310-23-100UG | 100UG |
| Human TL-1A | 310-23-20UG | 20UG |
| Human sCD28 Fc | 310-34-20UG | 20UG |
| Human B7-2 Fc | 310-33-250UG | 250UG |
| Human TREM-1 Fc | 310-36-1MG | 1MG |
| Human ICOS Fc | 310-39-10UG | 10UG |
| Human sCD8alpha | 310-41-50UG | 50UG |
| Human sCD8alpha | 310-41-1MG | 1MG |
| Human TMIGD2/CD28H Fc | 310-42-500UG | 500UG |
| Murine sRANK Ligand (CHO derived) | 315-11C-100UG | 100UG |
| Murine sRANK Ligand (CHO derived) | 315-11C-250UG | 250UG |
| Murine LIGHT | 315-12-500UG | 500UG |
| Murine TPO | 315-14-10UG | 10UG |
| Murine sCD40 Ligand | 315-15-25UG | 25UG |
| Murine Sonic Hedgehog (Shh) | 315-22-1mg | 1MG |
| Murine Adiponectin | 315-26-500UG | 500UG |
| Murine Amphiregulin | 315-36-50UG | 50UG |
| Murine Amphiregulin | 315-36-1MG | 1MG |
| Human ApoA-I | 350-11-500UG | 500UG |
| Rat IL-1beta | 400-01B-250UG | 250UG |
| Rat IL-2 | 400-02-20UG | 20UG |
| Rat IL-4 | 400-04-250UG | 250UG |
| Human C5a | 300-70-100UG | 100UG |
| Human sRANK Ligand (E.coli derived) | 310-01-500UG | 500UG |
| Human sRANK Ligand (CHO derived) | 310-01C-2UG | 2UG |
| Human sCD40 Ligand | 310-02-50UG | 50UG |
| Human sCD40 Ligand | 310-02-1MG | 1MG |
| Human LIGHT | 310-09B-15UG | 15UG |
| Human APRIL | 310-10C-100ug | 100UG |
| Human 4-1BB Ligand | 310-11-20UG | 20UG |
| Human sCD34 | 310-31-100UG | 100UG |
| Human B7-1 Fc | 310-32-500UG | 500UG |
| Human B7-2 Fc | 310-33-100UG | 100UG |
| Human TREM-1 Fc | 310-36-10UG | 10UG |
| Human ICOS Fc | 310-39-50UG | 50UG |
| Human ICOS Fc | 310-39-250UG | 250UG |
| Human PD-1 Fc | 310-40-100UG | 100UG |
| Murine TNF-alpha | 315-01A-50UG | 50UG |
| Murine sRANK Ligand (E.coli derived) | 315-11-2UG | 2UG |
| Murine Prolactin | 315-16-1MG | 1MG |
| Murine Adiponectin | 315-26-1MG | 1MG |
| Murine TFF-2 | 315-30-5UG | 5UG |
| Murine Prokineticin-2 | 315-38-100UG | 100UG |
| Human ApoE2 | 350-12-100UG | 100UG |
| Rat IL-1beta | 400-01B-10UG | 10UG |
| Rat IL-1beta | 400-01B-2UG | 2UG |
| Rat IL-2 | 400-02-50UG | 50UG |
| Murine GPR15L | 300-72-100UG | 100UG |
| Human sCD40 Ligand | 310-02-100UG | 100UG |
| Recombinant Human sTRAIL/Apo2L | 310-04-250UG | 250UG |
| Human CTLA-4 Fc | 310-05-50UG | 50UG |
| Human TWEAK | 310-06-100UG | 100UG |
| Human TWEAK | 310-06-500UG | 500UG |
| Human sTNF Receptor Type I | 310-07-1mg | 1MG |
| Human BAFF | 310-13-500UG | 500UG |
| Human sCD23 | 310-26-20UG | 20UG |
| Human HVEM-Fc | 310-27-20UG | 20UG |
| Human PD-L1 Fc | 310-35-20UG | 20UG |
| Human TREM-1 Fc | 310-36-50UG | 50UG |
| Human PD-L1 Fc | 310-35-500UG | 500UG |
| Human B7-H2 Fc | 310-37-500UG | 500UG |
| Human PD-L2 Fc | 310-38-250UG | 250UG |
| Human PD-1 Fc | 310-40-1MG | 1MG |
| Human sCD8alpha | 310-41-100UG | 100UG |
| Murine sRANK Ligand (E.coli derived) | 315-11-100UG | 100UG |
| Murine sRANK Ligand (CHO derived) | 315-11C-50UG | 50UG |
| Murine sRANK Ligand (CHO derived) | 315-11C-1MG | 1MG |
| Murine Prolactin | 315-16-100UG | 100UG |
| Murine TFF-2 | 315-30-100UG | 100UG |
| Murine Amphiregulin | 315-36-10UG | 10UG |
| Murine Amphiregulin | 315-36-250UG | 250UG |
| Human ApoE3 | 350-02-100UG | 100UG |
| Human ApoE2 | 350-12-1mg | 1MG |
| Rat IL-1alpha | 400-01A-500UG | 500UG |
| Rat IL-2 | 400-02-250UG | 250UG |
| Rat IL-5 | 400-05-2UG | 2UG |
| Rat IL-4 | 400-04-1MG | 1MG |
| Rat IL-5 | 400-05-100UG | 100UG |
| Rat IL-5 | 400-05-1mg | 1MG |
| Rat IL-7 | 400-07-1MG | 1MG |
| Rat GRO/KC (CXCL1) | 400-10-5UG | 5UG |
| Rat GRO/KC (CXCL1) | 400-10-500UG | 500UG |
| Rat GRO-beta/MIP-2 (CXCL2) | 400-11-250UG | 250UG |
| Rat MCP-1 (CCL2) | 400-12-250UG | 250UG |
| Rat MIP-1alpha (CCL3) | 400-15-250UG | 250UG |
| Rat IL-13 (113 a.a.) | 400-16L-100UG | 100UG |
| Rat IL-13 (109 a.a.) | 400-16-10UG | 10UG |
| Rat IL-10 | 400-19-500UG | 500UG |
| Rat IL-10 | 400-19-2UG | 2UG |
| Rat SCF | 400-22-250UG | 250UG |
| Rat Prolactin | 400-27-1MG | 1MG |
| Rat M-CSF | 400-28-50UG | 50UG |
| Rat sRANK Ligand | 400-30-10UG | 10UG |
| Rat SDF-1alpha (CXCL12) | 400-32A-50UG | 50UG |
| Rat SDF-1beta (CXCL12) | 400-32B-250UG | 250UG |
| Rat IP-10 (CXCL10) | 400-33-250UG | 250UG |
| Rat G-CSF | 400-37-100UG | 100UG |
| Rat IL-21 | 400-41-2UG | 2UG |
| Human MMP-2 | 420-02-10UG | 10UG |
| Human NT-4 | 450-04-50UG | 50UG |
| Human OPG | 450-14-10UG | 10UG |
| Human OPG | 450-14-250UG | 250UG |
| Human Midkine | 450-16-100UG | 100UG |
| Human RELMbeta | 450-22-25UG | 25UG |
| Human Adiponectin | 450-24-500UG | 500UG |
| Murine RELMgamma | 450-26G-25UG | 25UG |
| Human Galectin-3 | 450-38-500UG | 500UG |
| Human sCD30 Ligand | 450-42-1MG | 1MG |
| Human Enterokinase | 450-48C-10UG | 10UG |
| Human Enterokinase | 450-48C-500UG | 500UG |
| Lysobacter Enzymogenes Arg-C | 450-54-500ug | 500UG |
| Murine Artemin | 450-58-20UG | 20UG |
| Murine Artemin | 450-58-1MG | 1MG |
| Rat IL-7 | 400-07-2UG | 2UG |
| Rat IL-7 | 400-07-100UG | 100UG |
| Rat TNF-alpha | 400-14-100UG | 100UG |
| Rat MIP-1alpha (CCL3) | 400-15-50UG | 50UG |
| Rat TNF-alpha | 400-14-1MG | 1MG |
| Rat IL-13 (113 a.a.) | 400-16L-2UG | 2UG |
| Rat IL-13 (109 a.a.) | 400-16-2UG | 2UG |
| Rat IL-9 | 400-18-250UG | 250UG |
| Rat IL-9 | 400-18-1MG | 1MG |
| Rat IL-15 | 400-24-10UG | 10UG |
| Rat Fractalkine (CX3CL1) | 400-26-1MG | 1MG |
| Rat M-CSF | 400-28-2UG | 2UG |
| Rat sRANK Ligand | 400-30-250UG | 250UG |
| Rat SDF-1alpha (CXCL12) | 400-32A-100UG | 100UG |
| Rat SDF-1alpha (CXCL12) | 400-32A-10UG | 10UG |
| Rat G-CSF | 400-37-50UG | 50UG |
| Rat IL-21 | 400-41-10UG | 10UG |
| Human TIMP-2 | 410-02-100UG | 100UG |
| Human MMP-1 | 420-01-500UG | 500UG |
| Human MMP-2 | 420-02-100UG | 100UG |
| Human MMP-3 | 420-03-100UG | 100UG |
| Human Neurturin | 450-11-1mg | 1MG |
| Human Midkine | 450-16-50UG | 50UG |
| Human Artemin | 450-17-1MG | 1MG |
| Human NNT-1/BCSF-3 | 450-18-10UG | 10UG |
| Human gAcrp30/Adipolean Variant | 450-20-100UG | 100UG |
| Human gAcrp30/Adipolean | 450-21-1mg | 1MG |
| Human RELMbeta | 450-22-100UG | 100UG |
| Murine RELMbeta | 450-26B-250UG | 250UG |
| Murine RELMgamma | 450-26G-250UG | 250UG |
| Murine gAcrp30 | 450-27-25UG | 25UG |
| Human Galectin-3 | 450-38-100UG | 100UG |
| Human Furin | 450-47-1mg | 1MG |
| Lysobacter Enzymogenes Arg-C | 450-54-100ug | 100UG |
| Rat MIP-1beta (CCL4) | 400-09-100UG | 100UG |
| Rat GRO-beta/MIP-2 (CXCL2) | 400-11-25UG | 25UG |
| Rat MCP-1 (CCL2) | 400-12-100UG | 100UG |
| Rat TNF-alpha | 400-14-250UG | 250UG |
| Rat IL-13 (109 a.a.) | 400-16-1MG | 1MG |
| Rat Leptin | 400-21-5MG | 5MG |
| Rat SCF | 400-22-50UG | 50UG |
| Rat GM-CSF | 400-23-250UG | 250UG |
| Rat IL-15 | 400-24-250UG | 250UG |
| Rat Prolactin | 400-27-10UG | 10UG |
| Rat Prolactin | 400-27-500UG | 500UG |
| Rat sRANK Ligand | 400-30-1MG | 1MG |
| Rat Resistin | 400-35-250UG | 250UG |
| Recombinant Rat Oncostatin M | 400-36-500UG | 500UG |
| Human TIMP-1 | 410-01-500UG | 500UG |
| Human TIMP-1 | 410-01-100UG | 100UG |
| Human MMP-1 | 420-01-1mg | 1MG |
| Human Artemin | 450-17-100UG | 100UG |
| Human gAcrp30/Adipolean | 450-21-100UG | 100UG |
| Human RELMbeta | 450-22-500UG | 500UG |
| Murine RELMalpha | 450-26-500UG | 500UG |
| Murine RELMgamma | 450-26G-5UG | 5UG |
| Murine Persephin | 450-35-500UG | 500UG |
| Human/Rat Neuritin | 450-36D-250UG | 250UG |
| Human GMF-beta | 450-37-10UG | 10UG |
| Human Galectin-1 | 450-39-1MG | 1MG |
| Human sCD30 Ligand | 450-42-500UG | 500UG |
| Staphylococcus Glu-C | 450-46-500UG | 500UG |
| Human Furin | 450-47-500ug | 500UG |
| Human IFN-gamma | AF-300-02-1MG | 1MG |
| Human IL-15 | 200-15-2UG | 2UG |
| Human IL-2 | 200-02-500UG | 500UG |
| Murine IL-13 | 210-13-2UG | 2UG |
| Human IL-33 | 200-33-10UG | 10UG |
| Human MMP-1 | 420-01-100UG | 100UG |
| Human MMP-1 | 420-01-50UG | 50UG |
| Human MMP-2 | 420-02-250UG | 250UG |
| Human MMP-3 | 420-03-500UG | 500UG |
| Human CDNF | 450-05-100UG | 100UG |
| Human CDNF | 450-05-500UG | 500UG |
| Human MANF | 450-06-250UG | 250UG |
| Human Neurturin | 450-11-500UG | 500UG |
| Human OPG | 450-14-50UG | 50UG |
| Human NNT-1/BCSF-3 | 450-18-250UG | 250UG |
| Murine gAcrp30 | 450-27-5UG | 5UG |
| Murine Resistin | 450-28-1MG | 1MG |
| Murine Persephin | 450-35-250UG | 250UG |
| Yeast Kex-2 | 450-45-1mg | 1MG |
| Human Furin | 450-47-2UG | 2UG |
| Human Enterokinase | 450-48C-50UG | 50UG |
| Rat IFN-gamma | 400-20-20UG | 20UG |
| Human IL-15 | AF-200-15-2UG | 2UG |
| Murine TNF-alpha | 315-01A-100UG | 100UG |
| Human IL-2 | AF-200-02-100UG | 100UG |
| Human IL-21 | AF-200-21-100UG | 100UG |
| Human IL-3 | 200-03-100UG | 100UG |
| Murine EGF | 315-09-100UG | 100UG |
| Human FGF-4 | 100-31-25UG | 25UG |
| Human IL-21 | AF-200-21-10UG | 10UG |
| Murine IFN-gamma | AF-315-05-20UG | 20UG |
| Murine IL-5 | 215-15-5UG | 5UG |
| Murine IP-10 (CXCL10) Mini ABTS ELISA Development Kit | 900-M153 | 1kit |
| Murine C5a | 315-40-5UG | 5UG |
| Human IL-15 | 200-15-50UG | 50UG |
| Human GM-CSF | 300-03-100UG | 100UG |
| Human M-CSF | 300-25-10UG | 10UG |
| Murine GM-CSF | 315-03-100UG | 100UG |
| Murine SCF | 250-03-10UG | 10UG |
| Human IL-7 | AF-200-07-100UG | 100UG |
| Murine IL-21 | 210-21-100UG | 100UG |
| Murine IL-2 | 212-12-100UG | 100UG |
| Human IL-7 | 200-07-1mg | 1MG |
| Human IL-21 | 200-21-1MG | 1MG |
| Human IL-15 | 200-15-10UG | 10UG |
| Human IL-2 | 200-02-250UG | 250UG |
| Murine sRANK Ligand (E.coli derived) | 315-11-10UG | 10UG |
| Human IL-21 | AF-200-21-1MG | 1MG |
| Murine TPO | 315-14-50UG | 50UG |
| Murine M-CSF | 315-02-100UG | 100UG |
| Anti-Human IL-17F | 500-P90-50UG | 50UG |
| Human IL-17A | AF-200-17-5UG | 5UG |
| Rat M-CSF | 400-28-10UG | 10UG |
| Murine VEGF 165 | 450-32-10UG | 10UG |
| Human GM-CSF | 300-03-250UG | 250UG |
| Human IL-7 | 200-07-10UG | 10UG |
| Human IFN-gamma | AF-300-02-20UG | 20UG |
| Murine SCF | 250-03-100UG | 100UG |
| Murine SDF-1alpha (CXCL12) | 250-20A-10UG | 10UG |
| Murine GM-CSF | 315-03-5UG | 5UG |
| Human EGF | AF-100-15-1MG | 1MG |
| Human IL-4 | AF-200-04-20UG | 20UG |
| Human IL-11 | 200-11-10UG | 10UG |
| Human TNF-alpha | 300-01A-50UG | 50UG |
| Human SDF-1alpha (CXCL12) | 300-28A-1MG | 1MG |
| Human IL-3 | AF-200-03-10UG | 10UG |
| Human IL-6 | AF-200-06-5UG | 5UG |
| Human IL-2 | 200-02-50UG | 50UG |
| Human SCF | 300-07-50UG | 50UG |
| Human TPO | 300-18-50UG | 50UG |
| Human IL-4 | 200-04-50UG | 50UG |
| Human IFN-gamma | 300-02-20UG | 20UG |
| Murine M-CSF | 315-02-2UG | 2UG |
| Murine IL-4 | AF-214-14-20UG | 20UG |
| Human IL-1beta | 200-01B-2UG | 2UG |
| Human M-CSF | 300-25-50UG | 50UG |
| Murine IL-3 | 213-13-10UG | 10UG |
| Murine IFN-gamma | 315-05-100UG | 100UG |
| Murine IL-2 | 212-12-20UG | 20UG |
| Human FGF-10 | 100-26-25UG | 25UG |
| Human TGF-beta1 (HEK293 derived) | 100-21-10UG | 10UG |
| Murine IL-12 p70 | 210-12-2UG | 2UG |
| Murine IP-10 (CXCL10) | 250-16-25UG | 25UG |
| Murine IL-15 | 210-15-50UG | 50UG |
| Human IL-2 | 200-02-1MG | 1MG |
更多详情请联系
艾美捷科技有限公司
全国服务热线:400-6800-868
邮箱:sales@amyjet.com
网站:www.amyjet.com

GATTA quant有限公司成立于2014年,专注于超高分辨系统中探针的研制,使实验快速、简便、准确。这些探针通过使用特殊的纳米结构,即所谓DNA折纸技术精确定位放置染料分子,可使你测定的显微结果达到几纳米的分辨精度。为确保最优效果和性能,公司会根据您的意愿、要求和意图单独设计定制产品。
Gattaquant的主要产品包括:

GATTA-BEADS

GATTA-BEADS W
<<<
GATTA-CELLS:
GATTA-CELLS
GATTA-CELLS NIR

GATTA-SIM NANORULER

GATTA-STED NANORULER:
GATTA-STED NANORULER
GATTA-STED 3D NANORULER

GATTA-CONFOCAL NANORULER
Localization Based:
GATTA-PAINT HIRES
GATTA-PAINT NANORULER
GATTA-PAINT 3D – EXPERT AND ULTIMATE LINE
GATTA-STORM NANORULER

GATTA-AFM:
GATTA-AFM
GATTA-AFM 3D NANORULER

GATTA-GOLD
<<<<
GOLD NANOHELICES (L/R)

DNA-PAINT STARTER KIT
GATTAQUANT PRODUCT LEGACY
更多详情请联系
艾美捷科技有限公司
全国服务热线:400-6800-868
邮箱:sales@amyjet.com
网站:www.amyjet.com
" data-original="http://genvivo.51antibodies.com/template/company/xys_lvse/skin/image/lazyLoad.jpg" alt="GATTA quant"> GATTA quant
艾美捷科技特约代理F.S.T(Fine Science Tools)公司全系列产品。
F.S.T(Fine Science Tools)公司以追求高质量的产品和优质的服务为目标,为医护和科研人员提供医疗和动物精密手术器械,因而成为全球领先的手术器械生产商和供应商。F. S. T拥有手术剪、手术镊、骨科器械、手术刀及刀片、血管钳、持针钳等10余类共1000余种。
Fine Science Tools is the leading distributor of precision European surgical and microsurgical instruments to the scientific and biomedical research community.
Fine Science Tools公司的主要产品包括:
Scissors
Bone Instruments
Scalpels & Blades
Curettes, Spatulae & Probes
Pins
Wound Closure
Retractors
Vascular Instruments
<更多详情请联系
艾美捷科技有限公司
全国服务热线:400-6800-868
邮箱:sales@amyjet.com
网站:www.amyjet.com
" data-original="http://genvivo.51antibodies.com/template/company/xys_lvse/skin/image/lazyLoad.jpg" alt="Fine Science Tools"> Fine Science Tools
艾美捷科技代理Gene Tools品牌
Gene Tools是一家生产和销售Morpholino Anti-sense oligos(反义寡核苷酸)的公司,其产品专门用于基因调控的科学研究和药物开发。Gene Tools公司由多位资深科学家组成,为全球客户提供免费的技术咨询和Morpholino 序列设计服务。 Morpholino作为基因调控研究的最佳工具,已被广泛用于:阻断靶mRNA 翻译 (下调基因);诱导RNA选择性剪接 (下调或上调基因);阻断 miRNA;阻断病毒 RNA;阻断 non-coding RNA。
▍Morpholino介绍
Morpholino属于第三代反义寡核苷酸,主要通过阻断蛋白质翻译过程而达到抑制目标基因功能的作用,目前已经广泛用于发育生物学和细胞学实验中,并取得了非常好的实验效果。
Morpholino以吗啉环类似物为基本骨架,这种独特的结构特性使得Morpholino 具有以下几个特点:
● 与其他类型的反义寡核苷酸相比,Morpholino 能更好地抵抗核酸酶的作用;
● Morpholino 与靶序列结合后通过空间位阻效应发挥作用, 不激活RNaseH,不引起目标基因mRNA 的降解 ;
● 针对翻译起始位点区设计的Morpholino 用于抑制蛋白质的翻译,针对 pre-mRNA 剪切位点区设计的Morpholino 可影响mRNA 剪切,得到不 同的转录本,可以方便地用于目标基因结构域的突变研究;
● 与靶序列结合能力强,可以渗入mRNA 的二级结构, 并且特异性好。
配合Morpholino 的使用,Gene Tools公司开发了相应的递送系统,可以安全、高效地将Morpholino 输送至胞内,因此,Morpholino 也可以用于遗传学研究和新药靶标的发现以及验证。此外,Morpholino 可以标上荧光基团、亲和标签以及活性反应基团,以供不同的研究需要。

▍Gene Tools公司产品介绍
● Custom Morpholino:可以根据目标基因序列定制设计并合成Morpholino,用于体外细胞实验或某些直接显微注射的模型(如斑马鱼、非洲爪蟾胚胎)。
● Vivo-Morpholino:适用于活体动物模型(小鼠,大鼠,狗,灵长类等),细胞培养,器官培养等。通过特殊的末端修饰,提高了其穿透细胞膜进入组织细胞的能力,使得在成年动物(主要是小鼠、大鼠)中进行系统性基因功能研究成为可能。
● Prepared Control Oligos:根据特定需求合成细胞穿透肽偶联的 Morpholino。适用于活体动物模型(小鼠,大鼠,狗,灵长类等),细胞培养,器官培养等。
| 产品名称 | Short Description | Oligo sequence | SKU |
| Standard Control Oligo | Negative control oligo | CCTCTTACCTCAGTTACAATTTATA | PCO-StandardControl-100 |
| Vivo-Morpholino Standard Control Oligo | Negative Vivo-Morpholino control oligo | CCTCTTACCTCAGTTACAATTTATA | PCO-VivoStandardControl-100 |
| Random Control Oligo 25-N | 25-base random sequence mixture | NNNNNNNNNNNNNNNNNNNNNNNNN | PCO-RandomControl-25N-100 |
| Zebrafish p53 oligo | Danio rerio apoptosis suppression oligo | GCGCCATTGCTTTGCAAGAATTG | PCO-ZebrafishP53-100 |
| Zebrafish Chordin Positive Control Oligo | Danio rerio Chordin positive control oligo | ATCCACAGCAGCCCCTCCATCATCC | PCO-ZebrafishChordin-100-F |
| Clawed Frog Beta Catenin Positive Control Oligo | Xenopus laevis Beta Catenin antisense oligo | TTTCAACCGTTTCCAAAGAACCAGG | PCO-BetaCatenin-100-F |
| Green Fluorescent Protein Positive Control | Translation blocker for GFP target | ACAGCTCCTCGCCCTTGCTCACCAT | PCO-GFPControl-100 |
| Vivo-Morpholino GFP Positive Control | Translation blocker for GFP target (Vivo-Morpholino) | ACAGCTCCTCGCCCTTGCTCACCAT | PCO-VivoGFPControl-100 |
| Fluoresceinated Vivo-Morpholino Std Control | Negative Vivo-Morpholino control oligo with 5'Fluorescein | CCTCTTACCTCAGTTACAATTTATA | PCO-FluorVivoStandardControl-100-F |
● Endo-Porter:为了解决Morpholino在体外培养细胞中摄取效率低的问题,Gene Tools 开发了 Endo-Porter 这种特殊的转染试剂。它通过温和的内吞体逃逸机制帮助Morpholino进入细胞质。

STRECK, Inc.成立于1971年,是一家行业领先的专注于临床和科研产品研发与生产的公司。STRECK秉承创新、品质、服务的理念,为患者提供更快速准确的检测结果。STRECK的核心为稳定保存系列产品,其包括Cell Free DNA BCT、Cell Free RNA BCT、Cyto-Chex BCT、Cell Free DNA Urine Preserve及STRECK Cell Preservative, 该系列产品已广泛应用于临床研究、药物研发及疾病诊断等领域。
Established in 1971, Streck’s founder, Dr. Wayne Ryan, developed the company’s core technology of cell stabilization at a time when blood cells were still being counted manually using microscopes. Dr. Ryan, with a fierce passion for science and innovation, discovered that by isolating and stabilizing platelets, our laboratory scientists were able to facilitate automatic counting, leading to the development of an accurate system for calibrating platelet-counting devices. It was a profound breakthrough for hematology laboratories around the world – one that fueled our pursuit of innovative solutions for the clinical laboratory.
<

Streck的主要产品包括:
(1)标物
Body Fluids
Flow Cytometry
Chemistry
Hematology
Sickle Cells
Urinalysis
(2)收集
Collect Tubes
Preservatives
Thermometers
<更多详情请联系
艾美捷科技有限公司
全国服务热线:400-6800-868
邮箱:sales@amyjet.com
网站:www.amyjet.com
" data-original="http://genvivo.51antibodies.com/template/company/xys_lvse/skin/image/lazyLoad.jpg" alt="Streck"> Streck地址:武汉市洪山区光谷大道35号光谷总部国际时代 二期1栋1301
电话:17754422825
传真:18771997407
邮箱:sales@amyjet.com
0.4362